Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cyprinidherpesvirus 2 (CyHV-2) nested PCR (polymerase chain reaction) detection kit

A carp herpes virus and detection kit technology, applied in the determination/testing of microorganisms, methods based on microorganisms, microorganisms, etc., to achieve accurate and reliable results, improve detection sensitivity, and simplify detection procedures

Active Publication Date: 2013-01-02
YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no report of CyHV-2 nested PCR kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cyprinidherpesvirus 2 (CyHV-2) nested PCR (polymerase chain reaction) detection kit
  • Cyprinidherpesvirus 2 (CyHV-2) nested PCR (polymerase chain reaction) detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037]A nested PCR detection kit for carp herpesvirus type 2, including a box body (1), and six 1.5mL centrifuge tubes containing reagents are placed on the liner (2), including 10× reaction buffer (3 ), Taq enzyme (1U / μL) (4), primer P1 (containing CyHV-2P1F, CyHV-2P1R each 10 μM) (5), primer P2 (containing CyHV-2P2F, CyHV-2P2R each 10 μM) (6), pure Water (molecular biology grade) (7), positive DNA (10μg / mL) (8).

[0038] The formula of the 10× reaction buffer is: Tris-HCl 100mM, KCl 500mM, MgCl 2 15mM, dNTPs 2mM.

[0039] Described Tris-HCl is trihydroxymethylaminomethane hydrochloride; KCl is potassium chloride; MgCl 2 It is magnesium chloride; dNTPs is an equal-volume mixture of four deoxynucleotides required for DNA synthesis.

[0040] The various liquid reagents mentioned above are respectively packed in 1.5mL centrifuge tubes and placed in boxes.

[0041] Described primer nucleotide sequence is:

[0042] CyHV-2P1F is: TGAAATGTCAAAAAGTGGATGG

[0043] CyHV-2P1R is: ...

Embodiment 2

[0047] A nested PCR detection kit for carp herpesvirus type 2, comprising a box body 1, 6 1.5mL centrifuge tubes filled with reagents are placed on the box inner liner 2, including 10× reaction buffer 3, Taq enzyme (1U / μL) 4, primer P1 (including CyHV-2P1F, CyHV-2P1R each 10 μM) 5, primer P2 (including CyHV-2P2F, CyHV-2P2R each 10 μM) 6, pure water (molecular biology grade) 7, positive DNA ( 10 μg / mL) 8.

[0048] The formula of the 10×reaction buffer is: Tris-HCl 100mM, KCl 500mM, MgCl 215mM, dNTPs 2mM.

[0049] Described Tris-HCl is trihydroxymethylaminomethane hydrochloride; KCl is potassium chloride; MgCl 2 It is magnesium chloride; dNTPs is an equal-volume mixture of four deoxynucleotides required for DNA synthesis.

[0050] The using method of described kit comprises the following steps:

[0051] 1) Extraction of DNA from test samples before testing: Take an appropriate amount of gill filaments, spleen, and kidney tissues of dying diseased fish, homogenize them with a...

Embodiment 3

[0061] Detection of five naturally infected diseased fish tissue samples:

[0062] Randomly select crucian carp with typical symptoms, take an appropriate amount of gill tissue and homogenize it in a glass homogenizer, take 0.25 mL of the homogenate supernatant and use DNAzol to extract the virus DNA template, and use the reagents in the kit for nested PCR detection. The test results were analyzed by 1% (W / V) agarose gel electrophoresis and imaging system. The results show that (attached figure 2 ), the five crucian carp samples tested were all positive for CyHV-2, which was completely consistent with the observation results of electron microscope ultrathin sections.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Cyprinidherpesvirus 2 (CyHV-2) nested PCR (polymerase chain reaction) detection kit which is characterized in that six 1.5mL centrifuge tubes containing reagents are arranged on an inner pad (2) of a box body (1). The kit comprises a 10* reaction buffer, primers P1 and primers P2, wherein the 10* reaction buffer contains 100mM of Tris-HCL, 500mM of KCl, 15mM of MgCl2, 2mM of dNTPs (deoxyribonucleotide triphosphates) (3), and 1U / mu L Taq enzyme (4); the primers P1 contain 10mu M of CyHV-2 P1F and 10mu M of CyHV-2 P1R (5); and the primers P2 contain 10mu M of CyHV-2 P2F and 10mu M of CyHV-2 P2R (6), pure water (7) and 10mu g / mL positive DNA (deoxyribonucleic acid) (8). The sequences of the outer primers P1 are as follows: CyHV-2 P1F: TGAAATGTCAAAAGTGGATGG, and CyHV-2 P1R: TATTCCCAGACAGCCTTCAAA; and the sequences of the inner primers P2 are as follows: CyHV-2 P2F: GAACACCGCTGCTCATCATC, and CyHV-2 P2R: ACTCTTCGCAAGTCCTCACC. Two amplification processes are carried out by the inner and outer primers to finally obtain the DNA product of 357bp. The invention is simple to operate, is convenient and quick, and has the advantages of low detection limit, high sensitivity and accurate and reliable detection result.

Description

technical field [0001] The present invention relates to the field of detection of pathogens in aquaculture animals, and more specifically to a genetic detection kit for Cyprinidherpesvirus 2 (CyPrinidherpesvirus 2, CyHV-2), which is suitable for the diagnosis, import and export of Cyprinidherpesvirus 2 in aquaculture. Rapid detection of carp herpesvirus type 2 in inspection and quarantine. Background technique [0002] Carp herpesvirus type 2 (CyHV-2) is the pathogen of herpesviral haematopoietic necrosis (HVHN) that causes a large number of deaths in goldfish, so it is also called goldfish haematopoietic necrosis virus (GFHNV) . According to the systematic nomenclature rules of the International Committee on Taxonomy of Viruses, it was officially named Cyprinid herpesvirus 2 (CyHV-2). The virus was first discovered in the autumn of 1992 and spring of 1993 when it caused a mass death of farmed goldfish in western Japan, with a fatality rate as high as 100%. The disease su...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 徐进张辉曾令兵
Owner YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com