Supercharge Your Innovation With Domain-Expert AI Agents!

Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants

A plant, salt-tolerant technology, applied in the direction of microbial-based methods, applications, plant products, etc., can solve the problem of not seeing Heterococcus radiodurans, etc.

Active Publication Date: 2012-12-05
LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there may be an evolutionary synergy between radiation-tolerant strains and drought stress resistance, there is no research on the function of the trkB gene (DR1667, GeneID: 1799538) in Deinococcus radiodurans R1 in enhancing plant salt tolerance to report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants
  • Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants
  • Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Expression of D.radiodurans R1 trkB gene (DR1667) sequence in Escherichia coli

[0036] Design a pair of PCR-specific primers based on the published sequence of the trkB gene (DR1667) in the D. radiodurans R1 genome:

[0037] Up 5′ATTAACTAGTATGACCCGGAACGCCGCGCT 3′

[0038] Down 5′ACGCCATATGCTACCCCACCAGAATGTCGT3

[0039]The target gene sequence was amplified from D. radiodurans R1 genomic DNA by PCR method. Reaction conditions: 94°C for 10 min, 35 cycles of [94°C for 30 sec, 60°C for 30 sec, 72°C for 1.5 min], 72°C for 10 min. After the PCR product was recovered by gel, it was cloned on the vector pGEMT-easy, named pGEMT-trkB, and verified by sequencing; then the trkB gene (DR1667) with cohesive ends and pRADZ3 with promoter groEL were obtained by double digestion with SpeI / NdeI Vector, connect the trkB gene (DR1667) to the pRAD Z3 vector to construct the Escherichia coli expression vector pRADZ3-trkB G, transform the expression vector into Escherichia coli ...

Embodiment 2

[0041] Example 2 Salt tolerance experiment of recombinant strain containing D. radiodurans R1 trkB gene (DR1667)

[0042] 1. Experimental method

[0043] 1. Inoculate the 2 recombinant Escherichia coli obtained in Example 1 into 20mL LB liquid medium (containing Amp antibiotics) respectively, culture the shake flask overnight (37°C), and then transfer to 100mL LB liquid medium In the medium, try to keep the inoculum volume consistent, culture to OD 600 About 0.5 (try to keep OD 600 value is the same).

[0044] 2. After centrifuging 10 mL of the bacterial solution, shock it in an equal volume of 4M NaCl solution for 2 hours, and immediately dilute each sample to 10 times with sterile deionized water. -4 , Take 10 μL and spot on the surface of LB solid medium, culture at 37°C for 16 hours, observe the colony formation and take pictures.

[0045] 2. Experimental results

[0046] image 3 The results showed that the JM-trkB strain containing the D.radiodurans R1 trkB gene (D...

Embodiment 3

[0049] Example 3 Expression of trkB gene (DR1667) in rapeseed and identification of salt tolerance of transgenic plants

[0050] (1) Agrobacterium-mediated transformation of rapeseed experiment

[0051] 1. Preparation of competent Agrobacterium tumefaciens EHA105

[0052] 1) Pick a single colony, inoculate in 5mL YEB liquid medium (containing rifampicin Rif 50mg / L), shake and culture overnight at 28°C and 250 rpm;

[0053] 2) Take 2mL of bacterial liquid, add it to 50mL YEB liquid medium (containing Rif 50mg / L), shake at 28°C and 250rpm until OD 600 About 0.6 or so;

[0054] 3) Transfer the bacterial solution to a 50mL sterile centrifuge tube, bathe in ice for 30min, and centrifuge at 5000×g for 5min;

[0055] 4) Discard the supernatant and use 2mL 20mM CaCl for precipitation 2 Resuspended, 100 μL each was dispensed into 1.5 mL centrifuge tubes, and stored in liquid nitrogen for later use.

[0056] 2. Transformation of recombinant plasmid DNA into Agrobacterium

[0057] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discovers that trkB genes (DR1667) in Deinococcus radiodurans R1 are capable of enhancing resistance capability of prokaryotes and plants. Recombinant vectors comprising the trkB genes (DR1667) are constructed and are respectively transferred into prokaryotic and eukaryotic host cells. Experiments prove that salt tolerance of the prokaryotic host cells and rape can be enhanced after the trkB genes (DR1667) are expressed in the prokaryotic host cells and rape.

Description

technical field [0001] The present invention relates to the new function of the trkB gene (DR1667, GeneID: 1799538) of Deinococcus radiodurans R1, and specifically relates to the application of the gene in enhancing the resistance of plants to salt stress. Background technique [0002] The loss of crops caused by salinity ranks first among all abiotic stresses (Dracup et al., 1998). Deinococcus radiodurans R1 (D.radiodurans R1) is an ideal strain for studying the adaptation mechanism of microorganisms to abiotic stress because of its strong resistance to long-term desiccation and strong oxidative stress. [0003] HKT (high-affinity K+transporter) gene family transporter can regulate K in plants + / Na + The ability to balance is widely found in plants, fungi, eubacteria and archaea. Deinococcus radiodurans R1 (D.radiodurans R1) contains two HKT-like proteins, which are closely related to plant Na+ transport, and have strong resistance to long-term drying and strong oxidati...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/84A01H5/00C12N15/70C12N1/21C12R1/01C12R1/19
Inventor 林敏王劲左开井陈明张维平淑珍陆伟燕永亮
Owner LONGPING BIOTECHNOLOGY (HAINAN) CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More