Application of deinococcus radiodurans R1 trkB genes to cultivation of salt-tolerant plants
A plant, salt-tolerant technology, applied in the direction of microbial-based methods, applications, plant products, etc., can solve the problem of not seeing Heterococcus radiodurans, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Expression of D.radiodurans R1 trkB gene (DR1667) sequence in Escherichia coli
[0036] Design a pair of PCR-specific primers based on the published sequence of the trkB gene (DR1667) in the D. radiodurans R1 genome:
[0037] Up 5′ATTAACTAGTATGACCCGGAACGCCGCGCT 3′
[0038] Down 5′ACGCCATATGCTACCCCACCAGAATGTCGT3
[0039]The target gene sequence was amplified from D. radiodurans R1 genomic DNA by PCR method. Reaction conditions: 94°C for 10 min, 35 cycles of [94°C for 30 sec, 60°C for 30 sec, 72°C for 1.5 min], 72°C for 10 min. After the PCR product was recovered by gel, it was cloned on the vector pGEMT-easy, named pGEMT-trkB, and verified by sequencing; then the trkB gene (DR1667) with cohesive ends and pRADZ3 with promoter groEL were obtained by double digestion with SpeI / NdeI Vector, connect the trkB gene (DR1667) to the pRAD Z3 vector to construct the Escherichia coli expression vector pRADZ3-trkB G, transform the expression vector into Escherichia coli ...
Embodiment 2
[0041] Example 2 Salt tolerance experiment of recombinant strain containing D. radiodurans R1 trkB gene (DR1667)
[0042] 1. Experimental method
[0043] 1. Inoculate the 2 recombinant Escherichia coli obtained in Example 1 into 20mL LB liquid medium (containing Amp antibiotics) respectively, culture the shake flask overnight (37°C), and then transfer to 100mL LB liquid medium In the medium, try to keep the inoculum volume consistent, culture to OD 600 About 0.5 (try to keep OD 600 value is the same).
[0044] 2. After centrifuging 10 mL of the bacterial solution, shock it in an equal volume of 4M NaCl solution for 2 hours, and immediately dilute each sample to 10 times with sterile deionized water. -4 , Take 10 μL and spot on the surface of LB solid medium, culture at 37°C for 16 hours, observe the colony formation and take pictures.
[0045] 2. Experimental results
[0046] image 3 The results showed that the JM-trkB strain containing the D.radiodurans R1 trkB gene (D...
Embodiment 3
[0049] Example 3 Expression of trkB gene (DR1667) in rapeseed and identification of salt tolerance of transgenic plants
[0050] (1) Agrobacterium-mediated transformation of rapeseed experiment
[0051] 1. Preparation of competent Agrobacterium tumefaciens EHA105
[0052] 1) Pick a single colony, inoculate in 5mL YEB liquid medium (containing rifampicin Rif 50mg / L), shake and culture overnight at 28°C and 250 rpm;
[0053] 2) Take 2mL of bacterial liquid, add it to 50mL YEB liquid medium (containing Rif 50mg / L), shake at 28°C and 250rpm until OD 600 About 0.6 or so;
[0054] 3) Transfer the bacterial solution to a 50mL sterile centrifuge tube, bathe in ice for 30min, and centrifuge at 5000×g for 5min;
[0055] 4) Discard the supernatant and use 2mL 20mM CaCl for precipitation 2 Resuspended, 100 μL each was dispensed into 1.5 mL centrifuge tubes, and stored in liquid nitrogen for later use.
[0056] 2. Transformation of recombinant plasmid DNA into Agrobacterium
[0057] ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com