Application of transcription factor NFATC3 as drug target in reversing multidrug resistance of tumor
A multi-drug resistance and transcription factor technology, applied in the direction of antineoplastic drugs, drug combinations, medical preparations containing active ingredients, etc., can solve the problems of unseen applications and achieve the effect of less toxic and side effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Example 1 Detection of MDR1 mRNA transcription level in multidrug resistant tumor cells
[0026] experimental method:
[0027] Take MCF-7 / WT and MCF-7 / ADM respectively 1×10 5According to the method described in the operation manual of Trizol Reagent reagent, the total RNA of the above-mentioned cells was extracted; according to the method described in the operation manual of the reverse transcription kit iScript TM cDNA Synthesis Kit, the total RNA of the above-mentioned extracted cells was reverse-transcribed to obtain cDNA , the reverse transcription primer is the universal primer that comes with the above kit.
[0028] The mRNA transcript level of P-gp in MCF-7 / WT and MCF-7 / ADM was detected by Real-time fluorescent quantitative PCR. Real-time PCR amplification was carried out on the iCycler iQ fluorescent quantitative PCR instrument. Fluorescent quantitative PCR primer design: the upstream primer is 5'-GCCGGGAGCAGTCATCTGTGG T-3', the downstream primer is 5'-GAT C...
Embodiment 2
[0031] Example 2 Prediction and confirmation of transcription factor NFATC3 binding to MDR1 promoter region
[0032] experimental method:
[0033] The transcription factor binding site prediction software TESS (Transcription Element Search System) was used to predict the binding site of NFATC3 and MDR1 promoter region.
[0034] Using MCF-7 / WT and MCF-7 / ADM as samples, the combination of NFATC3 and MDR1 promoter was detected according to the method described in the operation manual of the nucleic acid protein precipitation kit chromatin Immunoprecipitation Assay kit, that is, the chromosome immunoprecipitation (CHIP) was first used technology to precipitate chromatin fragments associated with target proteins, and then detect the precipitated chromatin fragments by PCR. The experimental group and the control group were set up. The experimental group used NFATC3 antibody as the incubation antibody, and the control group used New Zealand rabbit pre-immune serum IgG (purified by ...
Embodiment 3
[0037] Example 3 Activation of transcription factor NFATC3 by extracellular calcium influx mediated by TRPC5
[0038] experimental method:
[0039] HEK293 cells stably expressing TRPC5 were seeded in 24-well plates at a density of 30,000 cells per well and placed in 5% CO 2 Co-transfection was carried out after culturing in a constant temperature cell incubator for 12 hours. The co-transfection system was: 0.2 μg reporter plasmid (mdr1-luc or NFAT-binding site deletion plasmid ΔTTTTCC-mdr1-luc, where ΔTTTTCC-mdr1-luc was obtained using site-specific The mutation kit Quick Change Site-directed Mutagenesis Kit was obtained by performing deletion mutation on the bases in the binding site region predicted by TESS in Example 2 according to the method described in the kit’s operation manual. The primer design: the upstream primer is 5’- GTAAACAAATGAATTTCCATAAAGCTAATTTATCTTTATAATACTTATTACTTCAAATTCTTGTTACATTT-3',下游引物为5'-AAATGAACAA GAATTTGAAGTAATAAGTATTATAAAGATAAATTAGCTTTATGGAAATTCATT...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com