Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Xylose isomerase producing method

A technology of xylose isomerase and gene is applied in the field of producing recombinant xylose isomerase and constructing microbial engineering bacteria to produce recombinant enzyme, so as to achieve the effect of improving performance and saving raw materials

Inactive Publication Date: 2012-10-24
INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, the current xylose isomerase products cannot meet and be suitable for the needs of the current market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Xylose isomerase producing method
  • Xylose isomerase producing method
  • Xylose isomerase producing method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] 1.1 Construction of Pichia pastoris expression vector

[0025] 1.1.1 Construction of cloning vector

[0026] A professional DNA sequence synthesis company synthesizes two base-complementary double strands containing ampicillin (AMP) gene sequence, polyclonal linker and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. named its cloning vector as pPM

[0027] 1.1.2 Acquiring genes

[0028] ①PCR amplification of the xylose isomerase gene of Thermus sp.

[0029] Primer 1:

[0030] 5'GC GAATTC ATGTACGAGCCCAAACCGG3'[Description. The 8 bases at the 5' end are enzyme-cleaved protection bases (2 small bases) and DNA restriction endonuclease recognition sites (the 6 underlined bases are enzyme recognition sites)]

[0031] Primer 2:

[0032] 5'CA GCGGCCGC TTA CCCCCGCACCCCCAGGAGGTACTCCACC3'[Explanation: 10 bases of 5' are restriction enzyme protectio...

Embodiment 2

[0085] 2.1 Construction of Saccharomyces cerevisiae expression vector

[0086] 2.1.1 Construction of cloning vector

[0087] A professional DNA sequence synthesis company synthesizes two base complementary double strands containing ampicillin (AMP) gene sequence, polyclonal adapter and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. The cloning vector was named pSM.

[0088] 2.1.2 Acquiring genes

[0089] ①PCR amplification of the xylose isomerase gene of Thermus sp.

[0090] Primer 1:

[0091] 5'GC GAATTC ATGTACGAGCCCAAACCGG3'[Description: The 8 bases at the 5' end are enzyme-cleaved protection bases (2 bases) and DNA restriction endonuclease recognition sites (the 6 bases underlined are enzyme recognition sites)]

[0092] Primer 2:

[0093] 5'CA GCGGCCGC TTA CCCCCGCACCCCCAGGAGGTACTCCACC3'[Explanation: 10 bases of 5' are restriction enzyme pro...

Embodiment 3

[0148] 3.1 Construction of Bacillus subtilis expression vector

[0149] 3.1.1 Construction of cloning vector

[0150] A professional DNA sequence synthesis company synthesizes two base-complementary double strands containing ampicillin (AMP) gene sequence, polyclonal linker and E. coli replication origin, and forms cohesive ends at both ends of each DNA strand sequence. It is circularized by the action of DNA ligase to form a DNA cloning vector. named its cloning vector as pBM

[0151] 3.1.2 Acquiring genes

[0152] ①PCR amplification of the xylose isomerase gene of Thermus sp.

[0153] Primer 1:

[0154] 5'GC GAATTC ATGTACGAGCCCAAACCGG3'[Description: The 8 bases at the 5' end are enzyme-cleaved protection bases (2 bases) and DNA restriction endonuclease recognition sites (the 6 bases underlined are enzyme recognition sites)]

[0155] Primer 2:

[0156] 5'CA GCGGCCGC TTA CCCCCGCACCCCCAGGAGGTACTCCACC3'[Explanation: 10 bases of 5' are restriction enzyme protection ba...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a xylose isomerase producing method and belongs to the technical field of biology. The xylose isomerase producing method includes: firstly, cloning xylose isomerase genes of thermus, streptomyces and escherichia coli; secondly, constructing a pichia pastoris expression vector, a saccharomyces cerevisiae expression vector and a bacillus subtilis expression vector which include three xylose isomerase gene expression cassettes, and transforming the vectors to corresponding host bacteria respectively; thirdly, respectively screening recombinants of over-expression xylose isomerases as engineering bacteria; and finally, fermenting the pichia pastoris engineering bacteria, the saccharomyces cerevisiae engineering bacteria and the bacillus subtilis engineering bacteria to produce a recombinant mixed xylose isomerase. Different from a traditional single-gene-coded xylose isomerase, the recombinant mixed xylose isomerase is wide in suitable reaction temperature and pH (potential of hydrogen) range and suitable for various purposes, and yield of the xylose isomerase expressed by the engineering bacteria including the polygene expression cassettes is obviously higher than that of the xylose isomerase expressed by engineering bacteria including single genes, so that production cost is reduced.

Description

technical field [0001] The invention belongs to the field of biotechnology and relates to the construction of microbial engineering bacteria to produce recombinant enzymes. Specifically, the recombinant xylose isomerase is produced by using microbial engineering bacteria. Background technique [0002] Xylose isomerase (Xylose Isomerase EC5.3.1.5) is an allosteric enzyme. The main function of xylose isomerase is to catalyze the interconversion of D-xylose (aldepentose) and D-xylulose (ketopentose), and also act on D-glucose to obtain D-fructose. Xylose isomerase is mainly used in fructose syrup industry, production of hemicellulose ethanol industry, as food additive and feed additive, etc. Different uses have different requirements for the suitable temperature and pH for the action of xylose isomerase. The isoamylase products currently on the market are derived from xylose isomerase produced by natural strains. Since the xylose isomerase gene in natural strains is encoded ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/90C12N15/81C12N15/75C12R1/465C12R1/19C12R1/01C12R1/84C12R1/865C12R1/125
Inventor 张爱联尹慧祥易国辉
Owner INST OF TROPICAL BIOSCI & BIOTECH CHINESE ACADEMY OF TROPICAL AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com