Potassium ion concentration detection kit and system thereof
A technology of potassium ion concentration and kit, which is applied in the field of biomedicine and can solve problems such as complex operation and large errors
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] The DNA capable of forming a G quadruplex used in this example is AGGGTTAGGGTTAGGGTTAGGG, and the cyanine dye used is a compound of the following formula
[0070]
[0071] 1) Prepare standard solution samples and test solutions
[0072] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 6.2 to prepare a DNA stock solution with a concentration of 200 μmol / L for later use.
[0073] Take 300 μL of methanol solution with a concentration of 200 μmol / L cyanine dye, add 19.2 ml of Tris-HCl buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.
[0074] Take 6 samples among them, add a certain amount of KCl solution with a concentration of 200mmol / L, and then use Tris-HCl buffer solution to make the volume to 2mL, and the concentrations of potassium ions are 0, 0.05, 0.1, 0.25, 0.5, 0.8mmol / L standard solution sample.
[0075] Add 20 μL of the urine sampl...
Embodiment 2
[0084] The DNA capable of forming a G quadruplex used in this example is TGAGGGTGGGGAGGGTGGGGAA DNA, and the cyanine dye used is a compound of the following formula
[0085]
[0086] 1) Prepare standard solution samples and test solutions
[0087] A certain amount of DNA was dissolved in boric acid-borax buffer solution with a pH value of 8.2 to prepare a DNA stock solution with a concentration of 200 μmol / L for later use.
[0088] Take 300 μL of methanol solution with a concentration of 600 μmol / L cyanine dye, add 19.2 ml of boric acid-borax buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.
[0089] Take 6 samples among them, add a certain amount of KCl solution with a concentration of 200mmol / L respectively, and then use boric acid-borax buffer solution to set the volume to 2mL, and the concentrations of potassium ions are respectively 0, 0.05, 0.1, 0.25, 0.5, 0.8mmol / L standard so...
Embodiment 3
[0098] The DNA capable of forming a G quadruplex used in this example is GGGCCAGGGAGCGGGGCGGAGGGGG, and the cyanine dye used is a compound of the following formula
[0099]
[0100] 1) Prepare standard solution samples and test solutions
[0101] A certain amount of DNA was dissolved in Tris-HCl buffer solution with a pH value of 7.2 to prepare a DNA stock solution with a concentration of 600 μmol / L for later use.
[0102] Take 300 μL of methanol solution with a concentration of 1.2 mmol / L cyanine dye, add 19.2 ml of Tris-HCl buffer, and then add 300 μL of DNA solution and mix well. Divide the above sample into 10 parts on average, each sample solution is 1.98mL.
[0103] Take 6 samples among them, add a certain amount of KCl solution with a concentration of 200mmol / L, and then use Tris-HCl buffer solution to make the volume to 2mL, so that the concentrations of potassium ions are 0, 0.05, 0.1, 0.25, 0.5, 0.8mmol / L standard solution sample.
[0104] Add 20 μL of the urin...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap