Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection primer for human IDH (isocitrate dehydrogenase) gene mutation and reagent kit

A technology for detecting primers and kits, applied in the field of biological detection reagents, can solve the problems of unsuitable high-throughput detection and large-scale clinical application, unsuitable for large-scale promotion and use, and labor-intensive, and achieves auxiliary tumor diagnosis and low cost. , Easy to operate and fast effect

Active Publication Date: 2012-10-17
HELIXGEN GUANGZHOU
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the labor intensity is slightly higher, professional technicians are required, and it is not suitable for high-throughput detection and large-scale clinical application
[0009] 4. SSCP, DHPLC, gene chip, liquid phase chip and other methods are complicated to operate and require high equipment. They are only used in laboratories of scientific research institutions and are not suitable for large-scale promotion and use.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection primer for human IDH (isocitrate dehydrogenase) gene mutation and reagent kit
  • Detection primer for human IDH (isocitrate dehydrogenase) gene mutation and reagent kit
  • Detection primer for human IDH (isocitrate dehydrogenase) gene mutation and reagent kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] In order to make the present invention easier to understand, specific embodiments of the present invention will be further described below. Example 1 The detection kit is used to detect whether IDH1 gene mutation occurs in glioma tumor tissue

[0055] The detection kit includes a reaction solution, which contains PCR buffer, dNTP mixture, MgCl 2 , primer pair, DNA polymerase, fluorescent dye, and DNase-free distilled water. Primer pairs are:

[0056] IDH1f: ACCAAATGGCACCATACGA (SEQ ID NO: 1),

[0057] IDH1r: TTCATACCTTGCTTAATGGGTGT (SEQ ID NO: 2).

[0058] The kit also includes a mutant control standard and a wild-type control standard.

[0059] The mutation of exon 4 of IDH1 gene in clinically collected glioma tumor tissue samples was detected.

[0060] Include the following steps:

[0061] 1. Sample processing and genomic DNA extraction: accept glioma tumor tissue samples from clinical surgical resection, cut the tumor tissue into pieces, and follow the DNA Mi...

Embodiment 2

[0074] Example 2 The detection kit is used to detect whether IDH2 gene mutation occurs in acute myeloid leukemia (AML) bone marrow cells

[0075] The detection kit includes a reaction solution, which contains PCR buffer, dNTP mixture, MgCl 2 , primer pair, DNA polymerase, fluorescent dye, and DNase-free distilled water. Primer pairs are:

[0076] IDH2f: AGTCCCAATGGAACTATCCG (SEQ ID NO: 3),

[0077] IDH2r: AAGCCAGCCTCACCTCGTC (SEQ ID NO: 4).

[0078] The kit also includes a mutant control standard and a wild-type control standard.

[0079] Detection of mutations in exon 4 of IDH2 gene in bone marrow samples from patients with clinical AML.

[0080] Include the following steps:

[0081] 1. Sample processing and genomic DNA extraction: accept bone marrow samples extracted from clinical AML patients, according to Genomic DNA was extracted according to the instructions of the Blood Mini Kit (Qiagen Biotechnology (Shanghai) Co., Ltd.). Adjust the DNA concentration to 2ng / μL ...

Embodiment 3

[0094] The clinical trial of embodiment 3 detection kits

[0095] Taking the Neurosurgery Department of Nanfang Hospital, Southern Medical University as the clinical trial unit, using the current gene mutation gold standard detection method--Sanger method gene sequencing as a contrast, the kit of the present invention (i.e. the kit of Example 1 or Example 2) was clinically tested. Experimental Research.

[0096] A total of 218 cases of paraffin pathological section specimens of clinical glioma were detected in clinical trials, 81 cases were positive in both the kit of the present invention and the gold standard Sanger method gene sequencing detection results, 135 cases were negative in both cases, and 2 cases of specimens with inconsistent results. The sensitivity (positive coincidence rate) of the kit of the present invention is 100%, the specificity (negative coincidence rate) is 98.54%, and the correct rate (total coincidence rate) is 99.08%. After the consistency test, th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a detection primer for human IDH (isocitrate dehydrogenase) gene mutation and a detection reagent kit, which are used for the combination of PCR (polymerase chain reaction) and high resolution melting curve analysis technique. The detection reagent kit can be used for detecting the gene mutation on IDH 1 and IDH2 gene exon 4, detection samples are human genomes DNA (deoxyribonucleic acid) extracted from tumor tissues, blood or bone marrow cells, and the detection reagent kit is used for patients with clinical brain glioma and hematopathy to assist tumor diagnosis, treatment and judging prognosis. The detection reagent kit is easy and rapid in operation and good in detection effect.

Description

technical field [0001] The invention relates to a biological detection reagent, more specifically, the invention relates to a detection primer and a kit for human IDH gene mutation (including IDH1 gene and IDH2 gene). Background technique [0002] Isocitrate dehydrogenase (IDH) is a key rate-limiting enzyme in the tricarboxylic acid cycle and plays an important regulatory role in the response to oxidative damage in cells. Since the IDH gene was found to be mutated in glioma in 2008, it has rapidly become a research hotspot. IDH gene mutation can be used as a specific indicator for the diagnosis of glioma, an effective molecular marker for grading and identification of glioma, and an independent factor for judging the prognosis of glioma patients. IDH mutations also occur in a small number of leukemias and myeloproliferative disorders (MPD) and other blood diseases. [0003] Human IDH has three subfamilies, IDH1, IDH2, and IDH3. IDH1 is located in the cytoplasm and peroxiso...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 吴岚晓曾庆姚飞谭杰锋
Owner HELIXGEN GUANGZHOU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com