Detection primer for human IDH (isocitrate dehydrogenase) gene mutation and reagent kit
A technology for detecting primers and kits, applied in the field of biological detection reagents, can solve the problems of unsuitable high-throughput detection and large-scale clinical application, unsuitable for large-scale promotion and use, and labor-intensive, and achieves auxiliary tumor diagnosis and low cost. , Easy to operate and fast effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] In order to make the present invention easier to understand, specific embodiments of the present invention will be further described below. Example 1 The detection kit is used to detect whether IDH1 gene mutation occurs in glioma tumor tissue
[0055] The detection kit includes a reaction solution, which contains PCR buffer, dNTP mixture, MgCl 2 , primer pair, DNA polymerase, fluorescent dye, and DNase-free distilled water. Primer pairs are:
[0056] IDH1f: ACCAAATGGCACCATACGA (SEQ ID NO: 1),
[0057] IDH1r: TTCATACCTTGCTTAATGGGTGT (SEQ ID NO: 2).
[0058] The kit also includes a mutant control standard and a wild-type control standard.
[0059] The mutation of exon 4 of IDH1 gene in clinically collected glioma tumor tissue samples was detected.
[0060] Include the following steps:
[0061] 1. Sample processing and genomic DNA extraction: accept glioma tumor tissue samples from clinical surgical resection, cut the tumor tissue into pieces, and follow the DNA Mi...
Embodiment 2
[0074] Example 2 The detection kit is used to detect whether IDH2 gene mutation occurs in acute myeloid leukemia (AML) bone marrow cells
[0075] The detection kit includes a reaction solution, which contains PCR buffer, dNTP mixture, MgCl 2 , primer pair, DNA polymerase, fluorescent dye, and DNase-free distilled water. Primer pairs are:
[0076] IDH2f: AGTCCCAATGGAACTATCCG (SEQ ID NO: 3),
[0077] IDH2r: AAGCCAGCCTCACCTCGTC (SEQ ID NO: 4).
[0078] The kit also includes a mutant control standard and a wild-type control standard.
[0079] Detection of mutations in exon 4 of IDH2 gene in bone marrow samples from patients with clinical AML.
[0080] Include the following steps:
[0081] 1. Sample processing and genomic DNA extraction: accept bone marrow samples extracted from clinical AML patients, according to Genomic DNA was extracted according to the instructions of the Blood Mini Kit (Qiagen Biotechnology (Shanghai) Co., Ltd.). Adjust the DNA concentration to 2ng / μL ...
Embodiment 3
[0094] The clinical trial of embodiment 3 detection kits
[0095] Taking the Neurosurgery Department of Nanfang Hospital, Southern Medical University as the clinical trial unit, using the current gene mutation gold standard detection method--Sanger method gene sequencing as a contrast, the kit of the present invention (i.e. the kit of Example 1 or Example 2) was clinically tested. Experimental Research.
[0096] A total of 218 cases of paraffin pathological section specimens of clinical glioma were detected in clinical trials, 81 cases were positive in both the kit of the present invention and the gold standard Sanger method gene sequencing detection results, 135 cases were negative in both cases, and 2 cases of specimens with inconsistent results. The sensitivity (positive coincidence rate) of the kit of the present invention is 100%, the specificity (negative coincidence rate) is 98.54%, and the correct rate (total coincidence rate) is 99.08%. After the consistency test, th...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap