Novel method for inhibiting primary liver cancer growth and metastasis
A technology for inhibiting liver cancer and treating liver cancer, which can be used in pharmaceutical formulations, gene therapy, genetic material components, etc., and can solve the problems of difficult treatment of liver cancer and high resistance to chemotherapy.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 miR-885-5p mimics inhibit the growth of subcutaneous tumors in NOD / SCID mice
[0020] (1) Digest well-grown wild-type human liver cancer SK-Hep-1 cells with trypsin, wash once with PBS and resuspend with DMEM basic medium to 1×10 8 cells / 4ml;
[0021] (2) Subcutaneously inject 200 μl of the treated cells in (1) into the right back of 5-6-week-old NOD / SCID male mice. After 10 days, tumors can be seen on the right back of the mice, and subcutaneous tumors can be formed in NOD / SCID mice. The model is built;
[0022] (3) Intratumoral injection of miR-885-5p mimic 2nM / 100μl, 2 times / week. Injected 6 times, and tracked the tumor volume. Among them, the miR-885-5p mimic was purchased from Guangzhou Ruibo Biotechnology Co., Ltd., and its specific name is miR-885-5p agomir, which contains double-stranded RNA, and the specific sequence of the sense strand of the double-stranded RNA is: 5'UCCAUUACACUACCUGCCUCU3' , the specific sequence of the antisense strand is: 5'A...
Embodiment 2
[0023] Example 2 miR-885-5p inhibits the metastasis of liver cancer
[0024] (1) Establishment of liver cancer stable cell lines with tracer effect
[0025] Plate six-well plates with 293T cells at a density of 1.5×10 6Cells / well for transfection; use lipo-2000 to transfect the lentiviral expression plasmid and lentiviral packaging plasmid containing the luciferase gene (the lentiviral expression system was purchased from Biosettia, USA) into the 293T plated the day before Cells; 16 hours after transfection, fresh DMEM medium was replaced, and the virus supernatant was collected 24 hours after the medium change, and stored in a -80°C refrigerator for later use; human liver cancer HCCLM3 cells were used to spread six-well plates at a density of 1×10 5 Cells / well, used for virus infection; after the virus supernatant is thawed at room temperature, mix 2 ml of full medium without antibiotics and 1 ml of virus supernatant into the HCCLM3 cell well, and add the cationic polymer ge...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com