Detection kit and detection method for viable bacteria in vibrio parahaemolyticus in food
A detection kit and technology for Vibrio parahaemolyticus, which are used in the detection of viable Vibrio parahaemolyticus in food, processed foods, and detection kits for Vibrio parahaemolyticus in food, can solve the problem that the accuracy of the detection results is very affected. Large, inability to distinguish between live bacteria and dead bacteria of Vibrio parahaemolyticus, and achieve the effect of consistent accuracy, high accuracy and convenient on-site application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: EMA-LAMP detection kit
[0030] A Vibrio parahaemolyticus EMA-LAMP detection kit, the kit includes the following components: 10× reaction buffer (200mM Tris-HCl, 100mM KCl, 10mM (NH 4 ) 2 SO 4 , 1.0% (mass volume ratio) Tritonx-100, pH 8.8), Bst DNA polymerase (New England Biolabs LTD), 10 mM dNTPs (New England Biolabs LTD), 100 mM MgSO 4 (New England Biolabs LTD), deionized water, primers (primer F3, primer B3, primer FIP, primer BIP, primer Loop-F, primer Loop-R), 1.5 mg / mL EMA (Sigma), 1000×SYBR Green I fluorescent dyes.
[0031] Table 1 Primer sequence list
[0032]
[0033] The above primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd.
Embodiment 2
[0034] Embodiment 2: EMA-LAMP detection kit detection method
[0035] A detection method for Vibrio parahaemolyticus viable bacteria in food, the detection method is divided into two cases, the first case is on-site rapid detection, and the second case is laboratory detection. It is suitable for on-site rapid detection. The main steps are divided into EMA processing samples, DNA template rapid extraction, EAM-LAMP amplification reaction, and method 3 in Example 2 is used to determine the detection results. The main steps applicable to laboratory detection include sample enrichment and culture, EMA treatment of samples, rapid extraction of DNA templates, and EAM-LAMP amplification reaction. Specific steps are as follows:
[0036] Sample enrichment culture: dried animal aquatic products, pickled raw animal aquatic products, ready-to-eat algae food, surimi products and other aquatic foods and aquatic condiments and other processed foods should be pre-enriched. That is, take 25g...
Embodiment 3
[0045] Embodiment 3: PCR detection test of Vibrio parahaemolyticus
[0046] According to the tlh gene sequence of Vibrio parahaemolyticus published in GenBank (Accession number: M36437), Primer 5 was used to design specific primers. The upstream primer is F1: AAAGCGGATTATGCAGAAGCACTG; the downstream primer F2 is: GCTACTTTCTAGCATTTTCTCTGC, and the amplified fragment size is about 450bp. The 20 μL amplification system includes: 2 μL 10× reaction solution, 1 μL DNA template, 1 μL (0.2 μM) of upstream and downstream primers, 2 μL dNTP mixture, 1 μL KOD-Plus Taq enzyme, 1 μL 25 mM MgSO 4 , 11 μL DNase / RNase-Free ddH 2 O. PCR reaction system: pre-denaturation at 94°C for 5 min, 30 cycles, each cycle at 94°C for 30s, 55°C for 30s, 68°C for 30s, and 68°C for 5min. The amplified products were separated by electrophoresis at 120V on a 2% (mass-to-volume ratio) agarose gel for 50 min, and the sample loading amount was 8 μL / sample hole.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com