Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rice blast resistance gene Piym2 and application thereof

A resistance gene, rice blast technology, applied in the field of genetic engineering, can solve the problems of weak resistance and easy loss of resistance, and achieve the effects of enhancing resistance, broadening resistance, and improving the efficiency of variety breeding

Active Publication Date: 2013-06-05
INST OF CROP SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among the cloned rice blast resistance genes, except for some resistance genes pi21 and Pb1 In addition, other genes show complete resistance, and its race specialization is strong, and the resistance is easy to lose; as for pi21 and Pb1 , although it has some characteristics of durable resistance, but the degree of resistance is weak, and it is difficult to really play a role in the year of rice blast pandemic

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice blast resistance gene Piym2 and application thereof
  • Rice blast resistance gene Piym2 and application thereof
  • Rice blast resistance gene Piym2 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Embodiment 1: rice blast resistance gene Piym2 Genetic analysis and preliminary localization of

[0040] In order to discover and identify new blast resistance genes, the susceptible japonica rice variety Lijiangxintuanheigu (LTH for short) and the local japonica rice variety Yangmaogu (YMG for short) that do not carry any main blast resistance gene were tested. ) to prepare a hybrid combination, using F 1 , F 2 and F 3 The group conducted in-depth research on the rice blast resistance genetics of YMG, identified and mapped Piym1 and Piym2 Two major resistance genes. in, Piym2 Resistance to the rice blast strain CH43 from the indica rice region of my country was located on the long arm of the rice chromosome 1 ( figure 1 ).

Embodiment 2

[0041] Embodiment 2: rice blast resistance gene Piym2 fine mapping and candidate gene prediction

[0042] The present invention utilizes map position cloning and bioinformatics method to clone resistance gene Piym2 . To fine-map this gene, use the F from LTH / YMG F 2 There were 1,990 extremely susceptible individual plants and 1,060 extremely disease-resistant individual plants isolated from the rice blast differential strains, through the use of linkage markers and F 3 Subsequent phenotype verification, will Piym2 Localized between markers CAPS2 and dCAPS5. In the Nipponbare reference sequence, this interval is 78.8 Kb and contains 10 candidate genes, of which 4 genes ( Os01g57270 , Os01g57280 , Os01g57310 and Pish ) are genes of NBS-LRR structure related to disease resistance, all of which are clustered on the clone B1100D10, spanning the interval of 52.0Kb. Sequencing found that the interval in YMG is about 43 Kb, and using FGENESH software (http: / / linux1.softbe...

Embodiment 3

[0043] Embodiment 3: rice blast resistance gene Piym2 Isolation of candidate genes and construction of vectors

[0044] in order to isolate Piym2 , according to the obtained sequence, design specific primers for the candidate gene by primer design software, and isolate the candidate gene by PCR with high-fidelity KOD enzyme (TOYOBO); the PCR amplification product is purified and ligated into pCAMBIA1305.1 and pCUbi1390 vector, and transformed into Escherichia coli Trans10 (TransGen Biotech) for preservation. The positive plasmid of the ligation product verified by enzyme digestion was sent to Beijing Biomed Technology Development Co., Ltd. for sequencing (Biomed).

[0045] 1. PCR amplification

[0046] According to the obtained sequences, the specific primers of the candidate genes were designed by primer design software, wherein the primer sequences were:

[0047] 1305F: CCATGATTACGAATTC TTTCATTAGGTGCACCCCACCCACAAG (SEQ ID NO. 3)

[0048] 1305R: TACCGAGCTCGAATTC TGAA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rice blast resistance gene Piym2 and application thereof, and provides the nucleotide sequence of the rice blast resistance gene Piym2 of paddy rice and the amino acid sequence of a protein coded by the rice blast resistance gene Piym2, and the gene is a member belonging to the CC-NBS-LRR resistance gene family. The invention also provides primers for amplifying the riceblast resistance gene Piym2 of paddy rice and the application of the gene in transforming paddy rice or other plants to breed disease-resistant varieties. When being transferred into diseased plants,the gene can help to produce new disease-resistant plants. In particular, hybridization and transformation methods can be used for adding a plurality of disease-resistant genes into plants, while theproblem of linkage drag in the genome, which appears in the conventional breeding technique, cannot occur, moreover, the breeding time can be shortened, and the variety-breeding efficiency can be increased.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to a rice blast resistance gene Piym2 Isolation, cloning and application. Background technique [0002] Rice is one of the most important food crops in the world, and more than half of the world's population uses rice as the main food. Rice blast is one of the most important diseases of rice. The annual rice production reduction caused by rice blast is 10% to 30%, and in severe cases, it reaches 30% to 50%, or even no harvest. In my country, rice blast occurs in an area of ​​about 3.8 million mu all year round, causing hundreds of millions of kilograms of rice losses and directly threatening the country's food security. [0003] Breeding and utilizing disease-resistant varieties has been recognized as the most cost-effective and environment-friendly control measures for rice blast. However, due to the complex population structure of Magnaporthe oryzae, its pathogenici...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N9/12C12N15/63C12N15/11A01H5/00
Inventor 万建民雷财林马建程治军许兴涛王久林张欣郭秀平
Owner INST OF CROP SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com