RCA (rolling circle amplification) rapid detection primer and kit for Yersinia enterocolitica
A technology for Yersinia enterocolitica and enterocolitis is applied in the field of rolling circle amplification rapid detection primers and kits for Yersinia enterocolitica, which can solve the problems of time-consuming and expensive application equipment, and achieve high High sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Example 1: Detection of Yersinia enterocolitica standard strain
[0046] Make the rolling circle amplification kit for Yersinia enterocolitica according to the following recipe:
[0047] 1) Probe binding reaction solution:
[0048] Each 8 μL contains 1 μL of 10×Taq DNA ligase buffer, 200 pmol L -1 Padlock probe 0.2μL, 40U·μL -1 Taq DNA ligase 0.1 μL, sterile double distilled water 6.7 μL.
[0049] The padlock probe described therein is SEQ ID NO: 3:
[0050] 5-GGACCATCAGGTGCGACATTTGCTTTCCCAATAGGTCCAGAATGTCAGCCGTTCCTCACCACCAGACTGCCATTCATCCGCTTATTATCACCGTTTGTCCTAATCTATG-3, 5' end phosphorylation modification;
[0051] 2) Exocut treatment reaction solution:
[0052] Each 10 μL contains 2 μL of 10× Exonuclease I buffer, 5 U·μL-1 Exonuclease I 3μL, sterile double distilled water 5μL.
[0053] 3) RCA constant temperature amplification reaction solution:
[0054] Each 21 μL contains 2.5 μL of 10×Bst DNA polymerase buffer, 10 μmol L -1 Primer XCF 1.25 μL, 10 μmol L -1 ...
Embodiment 2
[0069] Embodiment 2: the detection of Escherichia coli (ATCC 15922) standard bacterial strain
[0070] 1) Probe binding reaction solution:
[0071] Each 8 μL contains 1 μL of 10×Taq DNA ligase buffer, 200 pmol L -1 Padlock probe 0.2μL, 40U·μL -1 Taq DNA ligase 0.1 μL, sterile double distilled water 6.7 μL.
[0072] The padlock probe described therein is SEQ ID NO: 3:
[0073] 5-GGACCATCAGGTGCGACATTTGCTTTCCCAATAGGTCCAGAATGTCAGCCGTTCCTCACCACCAGACTGCCATTCATCCGCTTATTATCACCGTTTGTCCTAATCTATG-3, 5' end phosphorylation modification;
[0074] 2) Exocut treatment reaction solution:
[0075] Each 10 μL contains 2 μL of 10× Exonuclease I buffer, 5 U·μL -1 Exonuclease I 3μL, sterile double distilled water 5μL.
[0076] 3) RCA constant temperature amplification reaction solution:
[0077] Each 21 μL contains 2.5 μL of 10×Bst DNA polymerase buffer, 10 μmol L -1 Primer XCF 1.25 μL, 10 μmol L -1 Primer XCR 1.25 μL, 10 mmol L -1 dNTPs 0.6μL, 8U·μL -1 Bst DNA polymerase 0.4 μL, steril...
Embodiment 3
[0092] Example 3: Detection of food samples suspected of being infected with Yersinia enterocolitica
[0093] The food samples were subjected to DNA extraction and amplification detection according to the method described in Example 1. The electrophoresis results showed that the bands were 108, 216, and 324 in size from small to large, increasing at a speed of 108 bp, indicating that the sample to be tested was affected by the small intestine Infection by Yersinia coli.
[0094] The primers, probes and kits of the present invention can also detect Yersinia enterocolitica on other samples.
[0095]
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap