Rna interference mediated inhibition of the intercellular adhesion molecule 1 (icam-1)gene expression using short interfering nucleic acid (sina)
A technology that interferes with nucleic acids and molecules, applied in DNA/RNA fragments, genetic engineering, recombinant DNA technology, etc., can solve problems that hinder the development of effective vaccines
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0616] Example 1: Design, synthesis and identification of siNAs active against ICAM-1
[0617] ICAM-1 siNA synthesis
[0618] A series of 42 siNA molecules were designed, synthesized and evaluated for efficacy against ICAM-1. The main criteria for ICAM-1 design for human siNAs were (i) homology to ethnicity, and (ii) high power score as determined by a proprietary algorithm. Mouse sequences were also investigated for use in animal models. The effect of siNA on ICAM-1 RNA levels was also examined. The siNA sequences designed, synthesized and evaluated for efficacy against ICAM-1 are described in Table 1a (target sequences) and Table 1b (modified sequences).
[0619]Table 1a: ICAM-1 Target Sequences, Target Sites Indicated. Homology column indicates complete homology of siNA to human transcript (h), or mouse transcript (m).
[0620] duplex ID target sequence target site homology SEQ ID NO: 29281-DC CAGUGACUGUCACUCAGAGA 1650 h 1 29282-DC ...
Embodiment 2
[0692] Example 2: In vitro evaluation of siNA in human bronchial epithelial cells
[0693] Maximize ICAM-1 mRNA knockdown and potency in human bronchial epithelial cells as follows ( EC50) siNAs corresponding to duplex ID numbers 29961-DC, 29964-DC, 29984-DC, 29988-DC, 29957-DC, 29947-DC and 29956-DC were tested.
[0694] Cell culture preparation:
[0695] Human bronchial epithelial cells (NHBE cells) from Lonza (Cat. No. CC-2540) were grown at 37 °C in the presence of 5% CO2 and grown in BEBM minimal medium (Lonza, Cat. No. CC-3171) on Biocoat collagen 1 coated culture flask (Becton Dickinson).
[0696] Human lung epithelial carcinoma (Calu-1) cells were grown at 37°C in the presence of 5% CO2 and cultured in DMEM supplemented with 10% fetal bovine serum, glutamine, and antibiotics.
[0697] Transfection:
[0698] NHBE cells were plated in collagen 1-coated plates and cultured in appropriate medium. Cells were incubated at 37° C. for 24 hours in the presence of 5% C...
Embodiment 3
[0715] Example 3: Testing of siNAs for TLR3-mediated immune stimulation
[0716] Calu-1 or NHBE cells were processed as described above in Example 2 and used to measure endosomal TLR3-mediated immune stimulation, including poly I:C as a positive control for OAS1 mRNA upregulation. For the measurement of membrane-bound TLR3-mediated immune stimulation, Calu 1 cells were cultured at 12000 cells / 96 wells and administered at 100 nM, 30 nM, 10 nM, 3 nM, 1 nM, 0.3 nM in the absence of delivery vehicle in siRNA in PBS.
[0717] Endosomal TLR3-mediated expression was also measured by recording the percent increase in OAS1 mRNA levels when NHBE cells were transfected with siNA formulated with the delivery vehicle (Gemini Surfactant GSC170 Dab - Example 37 in WO03 / 82809). Immunostimulation (percentage increase in OAS1 mRNA levels relative to Gemini delivery vehicle). The TLR3 agonist Poly I:C was used as a positive control for OAS1 mRNA induction.
[0718] The results of the above im...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap