Kit for detecting lung cancer susceptibility genes
A technology of susceptibility genes and kits, which is applied in the field of kits for detection of lung cancer susceptibility genes, can solve problems such as linkage disequilibrium and poor independence of related genes, and achieve the effects of reducing morbidity, avoiding cross-infection, and improving survival
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] This embodiment provides a kit for detecting lung cancer susceptibility genes, which includes: a PCR reaction system, a PCR product purification system, and a sequencing reaction system.
[0056] Wherein, the PCR reaction system includes the following primers:
[0057] (1) Primers for the single nucleotide polymorphism site rs9387478 (C→A) on the DCBLD1 gene:
[0058] rs9387478 upstream primer: GGCAGAAAGGAAACAGTTGT (SEQ ID NO: 7);
[0059] rs9387478 downstream primer: ATGTTGGGAATTGTTGAGAC (SEQ ID NO: 8);
[0060] (2) Primers for the single nucleotide polymorphism site rs753955 (A→G) on the MIPEP gene:
[0061] rs753955 upstream primer: GCACCACACATTCTTAGGAC (SEQ ID NO: 9);
[0062] rs753955 downstream primer: TTATGGAGGCTGGCAAGTC (SEQ ID NO: 10);
[0063] (3) Primers for the single nucleotide polymorphism site rs36600 (T→C) on the MTMR3 gene:
[0064] rs36600 upstream primer: GTAGAATTGTTGGATCATAGG (SEQ ID NO: 11);
[0065] rs36600 downstream primer: GAGATGCCACTGAATT...
Embodiment 2
[0095] The difference between this example and Example 1 is that the PCR reaction system includes the following primers,
[0096] (1) Primers for the single nucleotide polymorphism site rs2285947 (G→A) on the DNAH11 gene:
[0097] rs2285947 upstream primer: AGTATGATGAGTTTGGAGCA (SEQ ID NO: 1);
[0098] rs2285947 downstream primer: GGAAATAAGCCAAACTGAGA (SEQ ID NO: 2);
[0099] (2) Primers targeting the single nucleotide polymorphism site rs2494938 (G→A) on the LRFN2 gene.
[0100] rs2494938 upstream primer: ACTAAGCCTCAGTCAAGGTTTG (SEQ ID NO: 3);
[0101] rs2494938 downstream primer: TAGCGAGGCATTTGGAACAG (SEQ ID NO: 4);
[0102] (3) Primers for the single nucleotide polymorphism site rs4488809 (T→C) on the TP63 gene:
[0103] s4488809 upstream primer: GGGAAGGTAGAATATATGAGT (SEQ ID NO: 5);
[0104] rs4488809 downstream primer: AAGCCCTCTCAATATCTG (SEQ ID NO: 6);
[0105] (4) Primers for the single nucleotide polymorphism site rs9387478 (C→A) on the DCBLD1 gene:
[0106] rs9...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com