Gene noninvasive detection kit for preventing neural tube defects of newborns

A technology for detecting kits and neural tubes is applied in the field of non-invasive gene detection kits for preventing neural tube defects in newborns, and can solve problems such as increased risk

Inactive Publication Date: 2012-04-04
解码(上海)生物医药科技有限公司
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And studies have shown that pregnant women with genotypes MTRR66GG and MTRR66AG have an increased risk of NTDs compared with normal controls

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene noninvasive detection kit for preventing neural tube defects of newborns
  • Gene noninvasive detection kit for preventing neural tube defects of newborns

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1. Use of detection kits

[0021] 1. Extract DNA template

[0022] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.

[0023] 2. PCR amplification reaction

[0024] Use the PCR reaction component in the detection kit, which contains the following primer pairs:

[0025] (1) MTHFR C677T forward primer: 5'CATCCCTCGCCTTGAACAG 3'

[0026] MTHFR C677T reverse primer: 5′CAGACACTGTTGCTGGGTTTT 3′

[0027] (2) MTHFR A1298C forward primer: 5'GCCTCCAGACCAAAGAGTTACAT 3'

[0028] MTHFRA1298C reverse primer: 5′ CCACTCCAGCATCACTCACTTT 3′

[0029] (3) MTRR A66G forward primer: 5'GATTCAAGCCCAAGTAGTTTCG 3'

[0030] MTRR A66G reverse primer: 5′GCTCTAACCTTATCGGATTCACTA 3′

[0031] The reaction system for PCR amplification is: 10×PCR reaction buffer 2.5μl; 25mM dNTP mixture 0.2μl, 5U / ul Taq enzyme 0.125μl, DNA template 1μl (about 12-15ng), 20uM forward primer and reverse primer Each 0.25μl,...

Embodiment 2

[0046] Example 2. Services for non-invasive detection of neural tube defect prevention genes for people

[0047] Sampling and Extracting DNA

[0048]The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells

[0049] Genotyping

[0050] Using the kit provided by the invention, the rs1801133 SNP site (MTHFR C677T) and the rs1801131 SNP site (MTHFR A1298C) and 5 on the 5,10-methylenetetrahydrofolate reductase gene of the subject's genomic DNA , SNP site rs1801394 (MTRR A66G) on the 10-methylenetetrahydrofolate reductase gene was sequenced separately to determine the genotypes of the six SNPs sites.

[0051] Risk assessment of female high-risk groups in children with neural tube defects

[0052] Through the analysis of the SNPs genotypes of the subjects, a female risk assessment and analysis report for giving birth to childr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a gene noninvasive detection kit for preventing neural tube defects of newborns. The kit comprises specific primers, DNA sequencing primers, a PCR (Polymerase Chain Reaction) reaction assembly, a PCR product purification assembly, a DNA sequencing reaction assembly and the like, wherein the specific primers are used for detecting No. rs1801133 SNP locus (MTHFR C677T) and No. rs1801131 SNP locus (MTHFR A1298C) on 5, 10-methylene tetrahydrofolate reductase (MTHFR) and No. rs1801394 SNP locus (MTRR A66G) on 5, 10-methylene methyl transferase reductase (MTRR). The kit evaluates the risk level of pregnant women giving birth to infants with neural tube defects by detecting the genotype of a single nucleotide polymorphism locus closely related to the main genetic factor causing newborn defects, namely female folic acid metabolism ability, and the pregnant women are individually instructed to supplement folic acid according to the gene detection result of each client. The method provided by the invention accords with the situation of our country, oral mucosa cell sampling is adopted as a sampling method which is painless and noninvasive, and cross infection is avoided. The sequencing detection results are accurate and reliable, expensive imported special instruments are not needed, and the method is easy to popularize and spread.

Description

technical field [0001] The invention belongs to the field of molecular biology, relates to medicine and biotechnology, and specifically relates to a gene detection kit for preventing neonatal neural tube defects. Single nucleotide polymorphism locus genotypes of hydrofolate reductase gene (MTHFR) and methionine synthase reductase gene (MTRR) were used to evaluate folic acid metabolism ability of pregnant women and guide their personalized folic acid supplementation. Background technique [0002] Neural tube defects (NTDs) have always been a deformity disease with high incidence in perinatal infants in my country. In 1986, the incidence rate of NTDs was 27.40 / 10,000, and dropped to 7.2 / 10,000 in 2007. However, in some high-incidence provinces, such as Shanxi, Shaanxi, Gansu, etc., the incidence rate is still as high as 30 / 10,000, which affects the birth quality of my country's population. Key factor. [0003] The occurrence of NTDs is the result of the joint action of genes ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68
Inventor 潘加奎姜丽
Owner 解码(上海)生物医药科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products