Method for recombinant expression of beta-amylase in bacillus subtillis in integrated mode
A technology of Bacillus subtilis and amylase, which is applied in the biological field, can solve the problems of breaking cell extraction, containing endotoxin, difficult to secrete and express, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0021] This example will include the overlapping promoter P43 promoter derived from Bacillus subtilis (Bacillus subtilis), the signal peptide DNA fragment of the α-acetolactate decarboxylase gene derived from Bacillus brevis (Bacillus brevis) and the H2S-producing fusiform derived from high temperature Clostridium thermosulfurogenes β-amylase gene monocistronic β-amylase expression element was cloned into the integrated plasmid pMLK83, then transformed into host strain WB600 to construct integrated recombinant Bacillus subtilis, and finally fermented in LB liquid medium Produces beta-amylase.
[0022] 1. Construction of recombinant plasmid pMLK83-P43
[0023] According to the promoter P43 sequence annotated in Genbank, the upstream primer was designed as 5'attgctggacgcttatggac 3' and the downstream primer was 5'cgggatccattcctctcttacctataat 3'. PCR reaction system 100ul: DNA template (Bacillus subtilis 1A751 total DNA) 1ul (about 20ng), 5×PrimeSTAR Buffer 20ul, 10pmol / ul dNTP ...
Embodiment 2
[0076] This example will include the promoter derived from the amyM maltose amylase gene of Bacillus lincheniformis (Baclicus lincheniformis), the signal peptide DNA fragment of the α-acetolactate decarboxylase gene derived from Bacillus brevis (Bacillus brevis) and the DNA fragment derived from barley (Hordeum vulgare ) The monocistronic β-amylase expression element of the β-amylase gene was cloned into the integrated plasmid pMLK83, and then transformed into the host strain WB600 to construct the integrated recombinant Bacillus subtilis, and finally fermented in LB liquid medium to produce β-amylase enzyme.
[0077] 1. Construction of recombinant plasmid pMLK83-amyM
[0078] According to the promoter amyM sequence annotated in Genbank, the upstream primer was designed as 5'cccaagcttctgtacacttgcgtcctcca 3' and the downstream primer was 5'cgggatcctctcctcccctttcaatgtg 3'. PCR reaction system 100ul: DNA template (Baclicus licheniformis ATCC 14580 total DNA) 1ul (about 20ng), 5×...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com