Pre-T carrier used for preparing eukaryon expression constructing body and preparation method and application thereof
A technology for eukaryotic expression vectors and expression constructs, which is applied to the preparation of pre-T vectors for eukaryotic expression constructs and the field of preparation thereof. It can solve the problems of difficult primers, low expression efficiency of target fragments, and cloning of PCR products, etc., to improve expression Efficiency and ease of primer design
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0048] The present invention will be further described below in conjunction with the accompanying drawings and the examples of preparing the target protein-myc-His tag fusion protein expression construct.
[0049] 1) Put pcDNA3.1(-) / myc-his A( figure 1 ) was double digested with EcoRI and KpnI.
[0050] 2) design such a pair of primers ( figure 2 )TANQ-F: AGAATTCGCCACCATGGCTCAATTGGCGTCCACCCGCGAGC and TANQ-R: TGGTACCAACTATTGTTTGGCAAGTTAGGTTTTGTC, the characteristics of this pair of primers are: the forward primer has a start codon ATG, with the A of ATG as the coordinate, its upstream base is expressed as -1 in sequence, -2, -3..., the downstream bases are sequentially expressed as +1, +2, +3...; from -2 to +12 is an XcmI restriction site, its sequence is CCATGGCT / CAATTGG, cut with XcmI After that, it can form a 3'T sticky end; from -6 to +4 is a Kozak sequence; from -12 to -7 is an EcoRI restriction site; the reverse primer contains an XcmI restriction site in turn and Kpn...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com