Tuberculosis antigen specific whole blood IFN-gamma diagnosis kit, method for producing the same and method for using same
A technology of diagnostic kits and application methods, which can be used in biological testing, material inspection products, measuring devices, etc., and can solve problems such as blocking the spread and prevalence of tuberculosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1 The amplification of the target gene of the present invention and the construction of expression vector
[0036] (1) First: design primers to amplify Rv3875 and Rv3874
[0037] Rv3875 upstream: GC GGATCC ATGACAGAGCAGCAGTG (SEQ.ID.NO.2)
[0038] Description: Single underline represents: BamHI restriction site
[0039] Downstream of Rv3875:
[0040] TGCGAACATCCCAGTGACGTTGCCTTC (SEQ.ID.NO.3)
[0041] Description: double underscore means: linker gene sequence
[0042] Rv3874 upstream:
[0043] ATGGCAGAGATGAAGACCGATG (SEQ.ID.NO.4)
[0044] Description: double underscore means: linker gene sequence
[0045] Downstream of Rv3874: CC AAGCTT TCAGAAGCCCATTTGCGAG (SEQ.ID.NO.5)
[0046] Note: The single underline represents the HindIII restriction site
[0047] Using the genomic DNA of the standard strain of Mycobacterium tuberculosis (H37Rv) as a template, the above primers were used to amplify CFP21 and MPT64 respectively. The PCR reaction conditions ...
specific Embodiment 2
[0050] Specific Example 2 High-efficiency expression of recombinant protein Rv3875-Rv3874 (SEQ.ID.NO.6) in Escherichia coli
[0051] The constructed expression vector pPro610 was transformed into Escherichia coli BL21(DE3) strain and highly expressed. The steps are as follows: activate the bacterium, transfer to 1 liter of LB culture medium and shake for 2-3 hours, and then induce with IPTG (1 mM) at 37° C. for different time. The cells were collected by centrifugation, added with 2×SDS loading buffer, and bathed in boiling water for 3 minutes, and the expression product was confirmed by 12.5% SDS-PAGE electrophoresis. see results figure 2 . Preserving the bacteria in glycerol is the engineering bacteria.
specific Embodiment 3
[0052] Purification of Specific Example 3 Recombinant Protein Rv3875-Rv3874
[0053] Centrifuge at 10000rpm for 10min to collect the induced expression engineered bacteria, and carry out SDS-PAGE electrophoresis detection on the lysed supernatant and the precipitate respectively. As a result, the required recombinant protein is found in the supernatant and the precipitate, and the protein purification operation follows the Ni-NTA purification system ( Invitrogen, USA) instructions. A brief overview of the steps is as follows, 50ml of the bacterial liquid was collected by centrifugation and resuspended in 8ml of guanidine hydrochloride lysate (6M guanidine hydrochloride, 20mM sodium phosphate pH 7.8, 500mM sodium chloride). After centrifugation for 10 min, the supernatant was added to Ni-NTA resin pretreated with denaturing binding buffer (8M urea, 200mM PBS pH 7.8, 500mM sodium chloride). Incubate at room temperature for 30min, wash the binding column twice with 4ml of denatu...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com