Recombinant antigen polypeptide for treating Alzheimer's disease and polypeptide gene
A technology for senile dementia and recombinant antigens, applied in the field of immunity, can solve the problems of poor immunogenicity, achieve the effect of enhancing immunogenicity and improving safety
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1: Preparation of recombinant antigen polypeptide IAβ28, comprising the following steps:
[0033] (1) Design the recombinant antigen polypeptide of the present invention
[0034] The recombinant antigen polypeptide IAβ28 of the present invention is designed such that its complete amino acid sequence is shown in SEQ ID NO: 5, which includes the sequence of SEQ ID NO: 3 (I) and SEQ ID NO: 1 (Aβ28).
[0035] (2) Synthesize the gene encoding IAβ28 and construct the recombinant expression vector
[0036] According to the amino acid sequence of the recombinant antigen polypeptide IAβ28 designed in the present invention, a gene fragment encoding IAβ28 was designed and artificially synthesized using a DNA synthesizer, and its sequence is as follows:
[0037] ggaattc catatg caggtgcagattcagagcctgtttctgttgttgctgtgggttccaggttctcgtgg
[0038] tgctaaatttgttgctgcctggaccctgaaagctgccgctggtggcggtcagtatattaaagctaatag
[0039] caaatttattggtattaccgaactggctgccgctgatgcagaattcc...
Embodiment 2
[0053] Example 2 Preparation of recombinant antigen polypeptide Aβ28-H8, comprising the following steps:
[0054] (1) Design the recombinant antigen polypeptide of the present invention
[0055] The recombinant antigenic polypeptide Aβ28-H8 of the present invention is designed such that its complete amino acid sequence is shown in SEQ ID NO: 6, which includes the sequence of SEQ ID NO: 1 (Aβ28) and the sequence of SEQ ID NO: 4 (H8). The recombinant SEQ ID NO: 4 (H8) sequence is not only a part of the recombinant antigen polypeptide, but also a purification tag of the expressed antigen polypeptide.
[0056] (2) Synthesize the gene encoding Aβ28-H8 and construct the recombinant expression vector
[0057] According to the amino acid sequence of the recombinant antigen polypeptide Aβ28-H8 designed in the present invention, a gene fragment encoding Aβ28 was first designed and artificially synthesized using a DNA synthesizer, and its sequence is as follows:
[0058] ggaattc cata...
Embodiment 3
[0068] Example 3 The preparation of recombinant antigen polypeptide IAβ35-H8 includes the following steps:
[0069] (1) Design the recombinant antigen polypeptide of the present invention
[0070] The design of the recombinant antigen polypeptide IAβ35-H8 of the present invention makes its complete amino acid sequence as shown in SEQ ID NO: 7, which includes SEQ ID NO: 3 (I) sequence, SEQ ID NO: 2 (Aβ35) and SEQ ID NO :4(H8) sequence. The recombinant SEQ ID NO: 4 (H8) sequence is not only a part of the recombinant antigen polypeptide, but also a purification tag of the expressed antigen polypeptide.
[0071] (2) Synthesize the gene encoding Aβ28-H8 and construct the recombinant expression vector
[0072] According to the amino acid sequence of the recombinant antigen polypeptide IAβ35-H8 designed in the present invention, a gene fragment encoding IAβ35 was first designed and artificially synthesized using a DNA synthesizer, and its sequence is as follows:
[0073] ggaattc ...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap