Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant antigen polypeptide for treating Alzheimer's disease and polypeptide gene

A technology for senile dementia and recombinant antigens, applied in the field of immunity, can solve the problems of poor immunogenicity, achieve the effect of enhancing immunogenicity and improving safety

Inactive Publication Date: 2009-07-15
JILIN UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, the use of full-length Aβ42 as an immunogen is potentially dangerous, because Aβ42 itself is a pathogenic factor, and as a small peptide, Aβ42 has a molecular weight of less than 10,000 and has poor immunogenicity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant antigen polypeptide for treating Alzheimer's disease and polypeptide gene
  • Recombinant antigen polypeptide for treating Alzheimer's disease and polypeptide gene
  • Recombinant antigen polypeptide for treating Alzheimer's disease and polypeptide gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1: Preparation of recombinant antigen polypeptide IAβ28, comprising the following steps:

[0033] (1) Design the recombinant antigen polypeptide of the present invention

[0034] The recombinant antigen polypeptide IAβ28 of the present invention is designed such that its complete amino acid sequence is shown in SEQ ID NO: 5, which includes the sequence of SEQ ID NO: 3 (I) and SEQ ID NO: 1 (Aβ28).

[0035] (2) Synthesize the gene encoding IAβ28 and construct the recombinant expression vector

[0036] According to the amino acid sequence of the recombinant antigen polypeptide IAβ28 designed in the present invention, a gene fragment encoding IAβ28 was designed and artificially synthesized using a DNA synthesizer, and its sequence is as follows:

[0037] ggaattc catatg caggtgcagattcagagcctgtttctgttgttgctgtgggttccaggttctcgtgg

[0038] tgctaaatttgttgctgcctggaccctgaaagctgccgctggtggcggtcagtatattaaagctaatag

[0039] caaatttattggtattaccgaactggctgccgctgatgcagaattcc...

Embodiment 2

[0053] Example 2 Preparation of recombinant antigen polypeptide Aβ28-H8, comprising the following steps:

[0054] (1) Design the recombinant antigen polypeptide of the present invention

[0055] The recombinant antigenic polypeptide Aβ28-H8 of the present invention is designed such that its complete amino acid sequence is shown in SEQ ID NO: 6, which includes the sequence of SEQ ID NO: 1 (Aβ28) and the sequence of SEQ ID NO: 4 (H8). The recombinant SEQ ID NO: 4 (H8) sequence is not only a part of the recombinant antigen polypeptide, but also a purification tag of the expressed antigen polypeptide.

[0056] (2) Synthesize the gene encoding Aβ28-H8 and construct the recombinant expression vector

[0057] According to the amino acid sequence of the recombinant antigen polypeptide Aβ28-H8 designed in the present invention, a gene fragment encoding Aβ28 was first designed and artificially synthesized using a DNA synthesizer, and its sequence is as follows:

[0058] ggaattc cata...

Embodiment 3

[0068] Example 3 The preparation of recombinant antigen polypeptide IAβ35-H8 includes the following steps:

[0069] (1) Design the recombinant antigen polypeptide of the present invention

[0070] The design of the recombinant antigen polypeptide IAβ35-H8 of the present invention makes its complete amino acid sequence as shown in SEQ ID NO: 7, which includes SEQ ID NO: 3 (I) sequence, SEQ ID NO: 2 (Aβ35) and SEQ ID NO :4(H8) sequence. The recombinant SEQ ID NO: 4 (H8) sequence is not only a part of the recombinant antigen polypeptide, but also a purification tag of the expressed antigen polypeptide.

[0071] (2) Synthesize the gene encoding Aβ28-H8 and construct the recombinant expression vector

[0072] According to the amino acid sequence of the recombinant antigen polypeptide IAβ35-H8 designed in the present invention, a gene fragment encoding IAβ35 was first designed and artificially synthesized using a DNA synthesizer, and its sequence is as follows:

[0073] ggaattc ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of immunity, in particular relates to recombinant antigen polypeptide for preventing and treating senile dementia and a fusion gene encoding the recombinant antigen polypeptide. The recombinant antigen polypeptide contains at least one immunopotetiation sequence and at least one human beta-amyloid peptide sequence, wherein, the human beta-amyloid peptide sequence is provided with an amino acid sequence as shown in SEQ ID NO:1 or SEQ ID NO:2, the immunopotetiation sequence is selected from SEQ ID NO:3, SEQ ID NO:4, a recombinant form of the SEQ ID NO:3 and the SEQ ID NO:4 or an amino acid sequence which has at least 90% homology with the two. The recombinant antigen polypeptide removes carboxyl-terminal toxic fragment of full-length human Abeta, improves safety of the antigen peptide Abeta, and recombines the immunopotetiation sequence, and enhances the immunogenicity of the antigen peptide Abeta.

Description

technical field [0001] The invention belongs to the technical field of immunization, and specifically relates to a recombinant antigen polypeptide for preventing and treating senile dementia and a fusion gene encoding the recombinant antigen polypeptide. Background technique [0002] Alzheimer's disease is a neurodegenerative disease, also known as Alzheimer's disease (Alzheimer disease, AD), one of its significant pathological features is the presence of neurotoxic β-β composed of 42 amino acids in the patient's brain. -Aggregate of amyloid peptide (β-amyloid peptide, Aβ or Aβ42, see Strooper BD, et al.Aninflammatory drug prospect.Nature.2001, 64(6860):159-160 for its amino acid sequence and further formed by it Amyloid plaques cause apoptosis of brain neurons, eventually leading to AD. The clinical manifestation of AD is dementia with mental symptoms: such as memory loss or even loss, cognitive impairment and behavioral slowness or even loss of ability, which brings a hea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/63A61K38/17A61K48/00A61P25/28
Inventor 张应玖王嘉鹏崔理立
Owner JILIN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com