Supercharge Your Innovation With Domain-Expert AI Agents!

Riemerella anatipestifer blood serum 1 type genetic engineering attenuated strain and construction method thereof

A technology of Riemer's anatipestifer and genetic engineering, which is applied in the field of genetically engineered attenuated strains of Riemerella anatipestifer serotype 1 and its construction, can solve the problem of N-acetylornithine aminotransferase gene correlation. reports, etc.

Inactive Publication Date: 2009-03-11
INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
View PDF0 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the N-acetylornithine aminotransferase gene in RA and its correlation with RA virulence have not been reported at home and abroad.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Riemerella anatipestifer blood serum 1 type genetic engineering attenuated strain and construction method thereof
  • Riemerella anatipestifer blood serum 1 type genetic engineering attenuated strain and construction method thereof
  • Riemerella anatipestifer blood serum 1 type genetic engineering attenuated strain and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] 1. Amplification and cloning of left and right arm gene fragments of Riemerella anatipestifer serotype 1 gene (△AcOAT gene, RA1 gene)

[0050] (1) Amplification primer synthesis

[0051] According to N-acetylornithine aminotransferase (N-acetylornithine aminotransferase, AcOAT) gene design PCR oligonucleotide amplification primers of left and right arm gene fragments. Left arm gene fragment: the upstream primer is 30 nucleotides long and contains a SalI restriction site 5-GGA GTC GAC GCGGTAAATAAGTAACTATGC-3 (the underline is the restriction site); the left arm extension primer is 51 nucleotides long, and the overlapping part is 39 nucleotides, 5-CCCAAATATTTA CTTATACGCCTAATGTTAAGGTTTCTCTTGTGCATAC TC -3 (overlapping sequences are underlined). Right arm gene fragment: the upstream primer is 30 nucleotides long and contains a Sal I restriction site 5-GGA GTC GAC CAAATATACACAAACTCTAGC-3 (the underline is the restriction site); the right arm extension primer is 51 nuc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an attenuated bacterial strain of Riemerella anatipestifer serum type 1 genetic engineering and a method for constructing the same, the method comprises the steps of: performing Sal I single enzyme digestion to a suicide plasmid pDS-132 and a Riemerella anatipestifer serotype 1 gene delta AcOAT, respectively, and using T4DNA ligase for connection to obtain pDS132::delta AcOAT suicide plasmid; transferring pDS-132:: delta AcOAT into a Riemerella anatipestifer serotype 1 gene GDGZ strain competent cell by electrotransformation, and screening recombinant mutant strains with a chloramphenicol resistant plate to obtain the attenuated strain of Riemerella anatipestifer serum type 1 genetic engineering. Animal tests show that 10-time LD50 dosage challenge tests show that the virulence of the attenuated strain has decreased remarkably without virulence basically and the attenuated strain can not reverse to virulence from avirulence and has the potential for preparing attenuated live vaccine.

Description

technical field [0001] The present invention relates to a nucleotide sequence of the Riemerella anatipestifer serum type 1 N-acetylornithine aminotransferase (AcOAT) gene, and also relates to Riemer anatipestifera constructed using the gene. Bacillus serotype 1 genetically engineered attenuated strain and its construction method. Background technique [0002] Riemerella anatipestifer (RA) disease is a highly pathogenic and contagious disease of ducks, geese, turkeys and other birds. 3 weeks old) ducklings, goslings and young turkeys. Riemerella anatipestifer presents as an acute or chronic septic process characterized mainly by neurological symptoms and fibrinous pericarditis, perihepatitis and air sacculitis. The sickness rate of this disease can reach more than 90%, and the lethal rate can be as high as more than 75%. The disease-resistant duck often grows into a defective duck or a stiff duck, and the feed conversion rate is reduced, and the growth and development are r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/54C12N15/63C12R1/01
Inventor 蔡建平袁建丰覃宗华吕敏娜吴彩艳余劲术
Owner INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More