Riemerella anatipestifer blood serum 1 type genetic engineering attenuated strain and construction method thereof
A technology of Riemer's anatipestifer and genetic engineering, which is applied in the field of genetically engineered attenuated strains of Riemerella anatipestifer serotype 1 and its construction, can solve the problem of N-acetylornithine aminotransferase gene correlation. reports, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] 1. Amplification and cloning of left and right arm gene fragments of Riemerella anatipestifer serotype 1 gene (△AcOAT gene, RA1 gene)
[0050] (1) Amplification primer synthesis
[0051] According to N-acetylornithine aminotransferase (N-acetylornithine aminotransferase, AcOAT) gene design PCR oligonucleotide amplification primers of left and right arm gene fragments. Left arm gene fragment: the upstream primer is 30 nucleotides long and contains a SalI restriction site 5-GGA GTC GAC GCGGTAAATAAGTAACTATGC-3 (the underline is the restriction site); the left arm extension primer is 51 nucleotides long, and the overlapping part is 39 nucleotides, 5-CCCAAATATTTA CTTATACGCCTAATGTTAAGGTTTCTCTTGTGCATAC TC -3 (overlapping sequences are underlined). Right arm gene fragment: the upstream primer is 30 nucleotides long and contains a Sal I restriction site 5-GGA GTC GAC CAAATATACACAAACTCTAGC-3 (the underline is the restriction site); the right arm extension primer is 51 nuc...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com