Method for constructing BmNPV- silkworm larvae multiple gene expression system
A construction method and expression system technology, applied in the construction field of BmNPV-bombyx mori larvae multi-gene expression system, can solve the problems of small amount of VLPs assembly, cumbersome operation, and difficulty in ensuring simultaneous entry of multiple baculoviruses
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0014] Embodiment 1: the method for constructing baculovirus-bombyx mori larvae multigene expression system
[0015] (1) Construction of donor plasmid
[0016] Such as figure 1 As shown, the cis-activating element oriT is derived from factor F and is responsible for the transfer of the donor plasmid. The specific construction process is as follows: Zeocin resistance gene (Em7-ZeoR) was amplified by PCR, and two homology arm sequences (HL and HR), two I-SceI sites, and BstBI were added to its two segments respectively , SacI, pmeI, AvrII and other enzyme cutting sites. The upstream and downstream primers are: ZeoR-F: 5'-TTCGAATA GGGATAACAGGGTAATACGCATCACTTACAACAGGGGGGACTATGAAATTATGCATTTGAGGATGCAGCACGTGTTGACAA-3'; ZeoR-R: 5'-GAGCTCTAGGGATAACAGGGTAATAAATGCAAATGTATTGTTATAGTATAATCCCTAATAATTTCATTGGATTGAACCCTA. The PCR product was first cloned into a T vector to obtain recombinant pSimple-Em7zeo, and then NcoI / SalI double enzyme digestion removed the Zeocin coding region and retai...
Embodiment 2
[0026] Example 2: Construction and expression of recombinant viruses carrying dual fluorescent reporter genes
[0027] (1) Construction of recombinant donor plasmid
[0028] The donor vector pHTdual was obtained according to the preparation method in (1) of Example 1, pDsRed2-1 was digested with BamHI / NotI, the red fluorescent protein gene DsRed fragment was recovered, and cloned into the vector pHTdual to obtain the recombinant plasmid pHTdual-DsRed. The pIRES-gfp was digested with SmaI / XhoI, and the gfp fragment of the green fluorescent protein gene was recovered, and cloned into the vector pUCDM to obtain the recombinant plasmid pUCDM-gfp.
[0029] (2) the construction of recipient bacterium recipient bacterium I-SceI DH10B; (3) the transformation of acceptor BmBacmid; (4) obtain recombinant BmBacmid; (5) the method that recombinant virus produces is according to (2) in embodiment 1 respectively , (3), (4), (5) steps are made.
[0030] (6) Expression of recombinant virus ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap