Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Test paper strip for rapidly detecting morbilli and rubella virus IgG antibody colloidal gold

A technology for detecting measles virus and test strips, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problems of high detection cost, complicated procedures, and long time, and achieve clear and easy to distinguish results, simple operation, and improved sensitivity and specificity Effect

Active Publication Date: 2009-02-11
辽宁迪浩生物科技有限公司
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this combination method is complex in procedure, takes a long time, and requires certain supporting experimental instruments, and the detection cost is high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Test paper strip for rapidly detecting morbilli and rubella virus IgG antibody colloidal gold
  • Test paper strip for rapidly detecting morbilli and rubella virus IgG antibody colloidal gold
  • Test paper strip for rapidly detecting morbilli and rubella virus IgG antibody colloidal gold

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Cloning expression of embodiment 1 measles virus H, rubella virus E1 specific antigen

[0027] (1) Amplification of MV.H protein gene

[0028] MV genomic RNA was extracted according to the Trizol method, and then the first strand of cDNA was synthesized according to the instructions of the reverse transcription kit. (GenBank accession number of MV.H protein gene is AB045300)

[0029] Then use primers 5'CGCA AGCTTCTATCTGCGATTGGTTCCA3' and 5'TTAGGATCCATGTCACCACA ACGAGACCG3' under the action of high-fidelity DNA polymerase, at 95°C for 3min; 94°C for 30S, 54°C for 35s, 72°C for 105S, 30 cycles; then extend at 72°C The condition of 10min amplifies the MV.H gene. The product was purified by PCR Product (Mini) Purification Kit.

[0030] virus recombination

[0031] The MV.H gene and the vector pGEMEX-1 (Promega) were placed in the double enzyme digestion system of BamHI and Hind-III, respectively, in a water bath at 37°C for 1 h, and the product was recovered using a rubb...

Embodiment 2

[0050] Embodiment 2: measles, rubella virus IgG antibody colloidal gold rapid detection test strip (seeing Fig. 1)

[0051] (1) Preparation of colloidal gold-antibody conjugates:

[0052] It was determined by experiments that the optimum binding pH value of colloidal labeling of anti-human IgG monoclonal antibody was 8.0, and the ratio of colloidal gold and antibody was 20 μg / ml colloidal gold respectively. After the labeled colloidal gold is treated with a stabilizer (0.5% BSA, pH8.0, 0.01M Tris buffer), take the colloidal gold-antibody conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on glass fiber, and freeze-dry , and stored in a dry environment.

[0053] (2) Coating antigen on nitrocellulose membrane:

[0054] The measles virus H antigen and rubella virus E1 antigen prepared in Example 1 were diluted to 3.5 mg / ml with 0.01 MPBS. Anti-mouse IgG polyclonal antibody was diluted to 2mg / ml with 0.01MPBS. Spray the two on the nitrocellulose memb...

Embodiment 3

[0060] Embodiment 3: method of use (see figure 2 )

[0061] Drop the sample to be tested (whole blood, plasma or serum) directly into the "4" of the test strip, and the sample solution goes up the membrane, and the result is interpreted within 10-15 minutes.

[0062] result:

[0063] If the sample contains measles virus and rubella virus IgG antibodies, it will form a corresponding complex with the colloidal gold-labeled anti-human IgG monoclonal antibody on the test strip, and go up with the measles virus H antigen and rubella virus coated on the nitrocellulose membrane. The combination of virus E1-specific antigens forms red lines, that is, red bands are formed at T1 and T2.

[0064] Regardless of whether it contains the corresponding antibody or not, the colloidal gold-labeled anti-human IgG monoclonal antibody continues to crawl upward and forms a red precipitation line with the anti-mouse IgG coated on the membrane, that is, a red band is formed at "C". This line is a ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a test strip for simultaneous detection of measles and rubella virus specific IgG antibodies, which comprises a reaction film and a conjugate release pad. The reaction film has a detection band simultaneously coated with measles virus H antigen and rubella virus E1 specific antigen, and a quality control band coated with double-antibody IgG. The conjugate release pad is coated with colloidal gold labeled anti-human IgG. The test strip is simple in operation, convenient, and fast, and has the advantages of no requirements of special instruments and special training, clear and identified result, and easy popularization. The test strip is suitable for base and site detection and epidemiological investigation, has auxiliary and differential diagnosis effects on measles and rubella virus infection, and can be used for the immune effect observation after vaccination.

Description

technical field [0001] The invention belongs to the field of biological detection, and in particular relates to a measles and rubella virus-specific IgG antibody detection test strip and an application thereof. Background technique [0002] Measles virus (MV) infection can not only cause acute infection symptoms such as fever, respiratory catarrh and systemic maculopapular rash, but also inhibit cell-mediated immunity, leading to secondary infections such as pneumonia and diarrhea. In a small number of cases, it can even cause serious complications such as encephalitis and persistent central nervous system infection. MV H protein (hemagglutinin protein) is a type II transmembrane glycoprotein with a molecular weight of 73-78kD, which can stimulate the body to produce effective humoral immunity and cellular immunity. MV.H protein is the main site of MV two types of receptors CD46 and SLAM, and initiates the infection of the virus; at the same time, it can also work with the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569G01N33/558G01N33/545
Inventor 刘明
Owner 辽宁迪浩生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com