Constant temperature nucleic acid amplification fast detecting reagent kit for bacillus coli O157 and use method thereof

Abstract

The invention discloses an escherichia coli O157 mediated isothermal nucleic acid amplification rapid detecting kit and a use method thereof. The kit comprises a primer mixed liquor, which adopts the sequence: an outer primer 1: GCTATACCACGTTACAGCGTG, an outer primer 2: ACTACTC AACCTTCCCCAGTTC, an inner primer 1: GCTCTTGCCACAGACTGCACATTCGTTGACTACTTC TTATCTGG, an inner primer 2: CTGTGACAGCTGAAGCTTTACGCGAAATCCCCTCTGAATTTGCC, a phosphate buffer solution PBS, paraformaldehyde, polylysine, lysozyme, proteinase K, RNase, BstDNA polymerase, a reaction solution, a sample pretreatment solution, a chromogenic agent, positive control and negative control. Highly specific, rapid, efficient and sensitive and simple situ detection for escherichia coli O157 can be realized through the escherichia coli O157 immobilized processing, cell permeability processing, mediated isothermal amplification for genes, and determining the results of the reaction products by using the kit.

Description

technical field [0001] The invention relates to a constant temperature nucleic acid amplification detection method, in particular to a rapid detection kit for Escherichia coli O157 constant temperature nucleic acid amplification and its usage. Background technique [0002] Enterohemorrhagic Escherichia coli (EHEC) O157 is an important zoonotic pathogen. It is mainly transmitted through food and water sources. The disease can cause diarrhea, hemorrhagic enteritis, secondary hemolytic uremic syndrome (HUS), thrombosis thrombocytopenic purpura (TTP) and so on. The condition of HUS and TTP is dangerous, and the case fatality rate is high. Since the bacteria was first isolated in the United States in 1982, there have been reports of distribution and outbreaks around the world. In recent years, more than ten provinces in my country have successively detected the pathogenic bacteria in food, poultry, livestock, insects and patients with diarrheal diseases, and there is a potentia...

AI Technical Summary

Problems solved by technology

However, in situ PCR has many disadvantages: (1) cells in the amplified product are damaged due to permeabilization and thermal cycling, which makes it difficult for us to use fluorescently labeled antibodies for simultaneous cell recognition; (2) ) The impermeability of the cell wall and the interference in the PCR amplification reaction caused by DNA polymerase inhibitors can produce false negative results; results, or positive results from nonspecifically bound labeled nucleotides through nick translation activity, can cause false positive results