Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Eukaryon expression shuttle vector, construction method and application

A carrier and recombinant carrier technology, applied in the direction of using carrier to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of cumbersome steps, low connection efficiency, high cost, etc., and achieve the effect of simple process, improved level, and good application prospects

Inactive Publication Date: 2011-04-06
CHINA AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traditional enzymatic digestion ligation method has problems such as cumbersome steps, high cost (need to purchase endonuclease and ligase), and low ligation efficiency. Electrophoresis, recovery and other steps before further connection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Eukaryon expression shuttle vector, construction method and application
  • Eukaryon expression shuttle vector, construction method and application
  • Eukaryon expression shuttle vector, construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1, the construction of pHP-DSV40

[0027] 1) Construction of pHP

[0028] Design primers pHP Vector1 upstream and pHP Vector1 downstream, pHP Vector2 upstream and pHPVector2 downstream, the sequences of primer pHP Vector1 upstream and pHP Vector1 downstream, pHP Vector2 upstream and pHP Vector2 downstream are as follows:

[0029] pHP Vector1 upstream: 5'ACATGTTCTTTCCTGCGCCGCTACAGGG3';

[0030] Downstream of pHP Vector1: 5'GAATTCTGCAGATATCCTCGAGCATGCATCTAG3'.

[0031] Upstream of pHP Vector2: 5'CTCGAGGATATCTGCA GATATOC AGCACAC3' (the underlined part is the EcoR V enzyme recognition site);

[0032] Downstream of pHP Vector2: 5'CCCTGTAGCGGCGCAGGAAAGAACATGT3'.

[0033] Using the pEGFP-N1 (Invitrogen) plasmid as a template, use primers pHP Vector1 upstream and pHP Vector1 downstream to PCR amplify fragment A, and use pCDNA3.0 plasmid as a template, use primers pHP Vector2 upstream and pHP Vector2 downstream to PCR amplify fragment B.

[0034] PCR reaction sys...

Embodiment 2

[0061] Embodiment 2, the ability of pHP-DSV40 to express protein

[0062] 1) Construction of pHP-DSV40 expressing green fluorescent protein

[0063] Design primers EGFP upstream and EGFP downstream, primer EGFP upstream and EGFP downstream sequences are as follows:

[0064] EGFP upstream: GGAATTCTGCAGAT TCGCCACCATGGTGAG;

[0065] Downstream of EGFP: ATGCATGCTCGAGGATTTACTTGTACAGCTCG.

[0066] The GGAATTCTGCAGAT and ATGCATGCTCGAGGAT sequences in the primers are sequences capable of homologous recombination with the nucleotide sequence at positions 700-715 at the 5' end of sequence 1 and the nucleotide sequence at positions 716-730 at the 5' end of sequence 1 .

[0067] Using the pEGFP-N1 plasmid as a template, the EGFP gene fragment was amplified by PCR with primers EGFP upstream and EGFP downstream.

[0068] Reaction system: 5 μL of 10×PCR Buffer, 1 μL of upstream and downstream primers, 1 μL of DNA template, MgCl 2 (25mM) 3μL, dNTPs (2.5mM each) 3μL, Pfu-Taq (5U / μL) 0.5μL...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an eucaryon expressing shuttle vector as well as a constructing method and applications thereof. The eucaryon expressing shuttle vector adopts an annular vector which comprises a prokaryon replication origin, two eucaryon replication origins, selective marker genes and a foreign gene expressing box; the foreign gene expressing box is composed of two promoters sharing an identical duplicating direction, connecting segments and polyadenylic acid tailing signals from upstream to downstream sequentially; and the connecting segment contains an EcoRV recognition sequence. The process of constructing the recombinant vector of expression foreign gene through the eucaryon expressing shuttle vector is convenient, quick, economical and highly efficient, and the vector contains two eucaryon replication origins, therefore, the vector can be greatly appreciated in cells expressing T antigen, and the protein expressing level can be improved. The eucaryon expressing shuttle vector has broad application prospect.

Description

technical field [0001] The invention relates to a eukaryotic expression shuttle vector and its construction method and application. Background technique [0002] Mammalian cell eukaryotic expression vectors are currently one of the most common expression vectors in the market, and are widely used in scientific research, production and other fields. Compared with prokaryotic protein expression vectors, proteins translated by mammalian cells undergo post-translational processing and modification, so they are far superior to prokaryotic expression systems and eukaryotic expression systems such as yeast and insect cells in terms of activity, and are closer to natural proteins . At present, many important proteins and glycoproteins have been expressed and produced by mammalian cell systems, and some products have been put into clinical application or trials. [0003] In the process of constructing and expressing exogenous gene plasmids in the eukaryotic expression protein plasm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/64
Inventor 刘金华刘芹防马广鹏蒲娟王帅
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com