Supercharge Your Innovation With Domain-Expert AI Agents!

Seed specific highly effective promoter and its application

A promoter and specific technology, applied in the application, the use of vectors to introduce foreign genetic material, biochemical equipment and methods, etc., can solve the problems of toxicity, different expression levels, hindering the normal growth of plants, etc.

Inactive Publication Date: 2010-09-22
CHINA AGRI UNIV
View PDF4 Cites 512 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the different expression levels of genes driven by constitutive promoters, some problems have gradually been exposed in the application: exogenous genes are expressed in the whole plant, producing a large number of heterologous proteins or metabolites that accumulate in the plant, breaking the original Metabolic balance, some products are even toxic, thus hindering the normal growth of plants and eventually leading to death
[0007] So far, the research and application of various crop seed-specific promoters have made great progress; however, the seed-specific promoters directly cloned or isolated from millet have not been reported at home and abroad, and there are no reports in China. no public use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Seed specific highly effective promoter and its application
  • Seed specific highly effective promoter and its application
  • Seed specific highly effective promoter and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. Cloning of millet seed-specific promoter sequence pF128

[0035] Millet 3661 seeds (Institute of Variety Resources, Chinese Academy of Agricultural Sciences) were sterilized on the surface, placed in a petri dish covered with moist filter paper, and cultivated at 24-28°C for 3-5 days to make young leaves grow, and 2g of fresh and tender seedlings were collected. The total DNA was extracted with the improved method of CTAB, and 2-3 μl DNA samples were taken, and the purity and concentration were detected by agarose gel electrophoresis.

[0036] According to the known F128 cDNA sequence [Xue J. et al, Cloning and Characterization of seed-specific Expression f128 Gene in Setariaitalica. Journal of Agricultural Biotechnology, 2004, 12(5): 505-508.], design and synthesize 3 nested primers SP1-SP3, and according to the Tail-PCR method of Liu Yao-Guang et al., synthesize 4 degenerate primers AD1-AD4, the primer sequences are as follows:

[0037] Sp1: 5'-AATTAGGTCTT...

Embodiment 2

[0049] Example 2. Isolation of millet seed-specific promoter sequence pF128

[0050] The following two primers were designed and synthesized, and a restriction endonuclease HindIII site and a restriction endonuclease XbaI site were respectively added to the 5' ends of the two primers for the needs of separation and construction in the future:

[0051] Primer 1: 5'TGCTCTAGACCTCTCTTGGATGCTAACACA 3'

[0052] wxya

[0053] Primer 2: 5'CCAAGCTTTGTGGAGAAGCAGAGAGAAG 3'

[0054] Hind III

[0055] Using the plasmid DNA pMDpS3A2 as a template, carry out PCR reaction, the reaction system is as follows:

[0056]

[0057] Amplification conditions: 95°C for 10 min; 95°C for 1 min, 58.5°C for 1 min, 72°C for 1 min, a total of 30 cycles; 72°C for 10 min. The results of electrophoresis detection showed that (attached figure 2 Shown), amplified to obtain a 1053bp DNA fragment. Recover with DNA gel recovery kit (Tiangen Technology Biochemical Co., Ltd.), subc...

Embodiment 3

[0058] Example 3. Construction of plant expression vector pBIpF128

[0059] Build process such as image 3 As shown, the pMDpF128 plasmid was extracted by alkaline lysis method, and the pF128 promoter fragment was obtained by HindIII and XbaI double enzyme digestion, which was ligated with the large fragment of the plant expression vector pBI121 after the same enzyme digestion, and then the ligated product was transformed into CaCl 2 In E. coli DH5α competent cells treated by the method, cultivate overnight on LB solid medium containing kanamycin (final concentration 100 μg / ml); pick the white colony grown on the plate, insert into containing kanamycin ( Cultivate overnight in LB liquid medium with a final concentration of 100 μg / ml, collect the bacteria by centrifugation and extract the plasmid pBIpF128 by alkaline lysis, and confirm that pBIpF128 contains the pF128 promoter after double digestion with restriction endonucleases HindIII and XbaI and PCR amplification fragment...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a special promoter separated from millet, expressing carrier with nucleic acid sequence of SEQ ID No. 1 host with the expressing carrier and appliance of the promoter, which is characterized by the following: utilizing Tail-PCR (colored body step moving method); getting the special promoter from gene group DNA; possessing nucleic acid sequence of SEQ ID No. 1; ;linking downstream of the promoter to non-homologous or homologous gene; constructing plant expressing carrier; transferring host plant; driving the downstream gene to high effective and special express goal protein in the seed; realizing genetic modification of plant; or using as effective tool for studying plant and biological reactor.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a seed-specific high-efficiency promoter sequence isolated from millet and its application. The above-mentioned seed-specific promoter is cloned from millet genomic DNA, and connected with different homologous and heterologous genes to construct a plant expression vector, transforming a host plant, and enabling the transgenic plant seeds to efficiently and specifically express their downstream genes. Method and application. Background technique [0002] During the research and development of transgenic plants, it was found that the low expression level of exogenous genes was often an important factor that resulted in the inability to obtain ideal transgenic plants and effectively study the mechanism of gene action. Since the key to affecting the expression level is the promoter upstream of the gene, the selection of a suitable plant promoter is the first consideration in enhancing th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C12N15/82
Inventor 于静娟梁翰文朱登云薛静赵倩敖光明
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More