Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

L-glutamate oxidase

a technology of l-glutamate and oxidase, which is applied in the field of new l-glutamate oxidase, can solve the problems of glutamate oxidase, the amino acid sequence of the enzyme, and the production process of l-glutamate oxidase not necessarily simpl

Inactive Publication Date: 2006-10-12
YAMASA SHOYU CO LTD
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The novel L-glutamate oxidase produced maintains enzymatic activity with distinct properties, including substrate specificity, molecular weight, pH stability, and coenzyme requirements, enabling efficient production and application in food analysis and neuroscience.

Problems solved by technology

However, production processes of L-glutamate oxidase are not necessarily simple.
X-119-6 is difficult to produce through liquid culturing, and therefore, solid culturing is employed to produce the enzyme.
However, hitherto, neither analysis of a gene encoding L-glutamate oxidase nor the amino acid sequence of the enzyme has been reported.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • L-glutamate oxidase
  • L-glutamate oxidase
  • L-glutamate oxidase

Examples

Experimental program
Comparison scheme
Effect test

example 1

Analysis of a Gene Encoding L-Glutamate Oxidase

(1) Probe

[0056] L-glutamate oxidase derived from Streptomyces sp. X-119-6 (ATCC 39343) is constituted by three subunits. In the present invention, the following probes (probe α and probe γ) were used. The probes were designed on the basis of the N-terminal amino acid sequences of α and γ subunits, which had been previously analyzed (α subunit: Ala-Asn-Glu-Met-Thr-Tyr-Glu . . . , γ subunit: Ala-Ile-Val-Thr-Ile-Pro-Phe . . . ).

[0057] Probe α: 5′-AACGAGATGAC(C or G)TACGAGCA-3′

(20 mers, 2 probes, (G+C) content=50%, Tm=60° C.)

[0058] Probe γ: 5′-GC(C or G)ATCGT(C or G)AC(C or G)ATCCC(C or G)TT-3′

(20 mers, 16 probes, (G+C) content=50%, Tm=64° C.)

(2) Cloning

[0059] A chromosomal DNA derived from Streptomyces sp. X-119-6 (ATCC 39343) was prepared through a conventional method, and the DNA was cleaved with BamHI. Subsequently, the resultant DNA fragments were subjected to agarose gel electrophoresis, to thereby obtain DNA fragments havin...

example 2

Production of L-Glutamate Oxidase by Use of E. coli (1)

[0071] The L-glutamate oxidase gene ORF was amplified through PCR by use of the following two primers (A) and (B) (purchased from Pharmacia) and, as a DNA sample, plasmid pGS1 containing a full-length L-glutamate oxidase gene.

Primer (A):5′-CCACACCGGGGCCGAATTCATGAACCGAGAT-3′Primer (B):5′-AGGTACTCGGCCACCCTGCAGGTC-3′

[0072] Amplification of the L-glutamate oxidase gene through PCR was performed by use of a GeneAmp PCR System 2400 (product of Perkin-Elmer Cetus Instrument) through 25 cycles of treatment, each cycle consisting of thermal denaturation (96° C., 10 seconds), annealing (55° C., 30 seconds), and polymerization (60° C., 120 seconds) of 50 μL reaction mixture which contained 10×PCR buffer (5 μL), 25 mM MgCl2 (5 μL), dNTP (8 μl), primer DNAs (A) and (B) (10 pmol each), the DNA sample (about 0.5 μg), and LA Tag DNA Polymerase (product of Takara Shuzo Co., Ltd.).

[0073] After amplification of the gene, a 3M sodium acetate so...

example 3

Production of L-Glutamate Oxidase by Use of E. coli (2)

[0086] The L-glutamate oxidase gene was amplified by use of an LA-PCR kit (product of Takara Shuzo Co., Ltd.), the following two primers (C) and (D), which were produced on the basis of the ORF nucleotide sequence obtained through the above analysis, and chromosomal DNA derived from Streptomyces sp. X-119-6 (ATCC 39343) serving as a template.

Primer (C):5′-GCGCCATGGAGGAATTCGCGCATGAACGAGATGACCTACGAGGAGCTGGCCGGC3′Primer (D):5′-GCGAAGCTTGATCATGACGTCAGTGCTTCCTCTCGCATC3′

[0087] Amplification of the L-glutamate oxidase gene by use of the LA-PCR kit was performed by means of a PCR Thermal Cycler (product of Takara Shuzo Co., Ltd.) through cycles of treatment, each cycle consisting of thermal denaturation (94° C.), annealing (68° C.), and elongation (68° C.) of GC buffer I•II solution (included in the LA-PCR Kit) containing dNTP, LA Tag, a template DNA (genomic DNA treated with SacI), and the primers (C) and (D).

[0088] After amplifica...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
pHaaaaaaaaaa
pHaaaaaaaaaa
Login to View More

Abstract

The present invention provides a novel L-glutamate oxidase, a gene encoding the enzyme, and a method for producing the enzyme. By use of a gene encoding the enzyme, L-glutamate oxidase can be readily prepared at low costs through a recombinant DNA technique. The novel L-glutamate oxidase has the following physicochemical properties: (A) action: catalyzing the following reaction: L-glutamic acid+O2+H2O→α-ketoglutaric acid+H2O2+NH3; (B) substrate specificity: being specific to L-glutamic acid; (C) molecular weight and subunit structure: molecular weight as determined through SDS-polyacrylamide gel electrophoresis of 70,000±6,000, molecular weight as determined through gel filtration of 140,000±10,000, and being a dimer formed of the same subunits having a molecular weight of 70,000±6,000; (D) optimum pH: around pH 6.0 to 8.5; (E) heat stability: being stable up to 60° C. at a pH of 7.4 for 30 minutes; and (F) coenzyme: flavin adenine dinucleotide (FAD).

Description

TECHNICAL FIELD [0001] The present invention relates to a novel L-glutamate oxidase; a gene encoding the enzyme, and a method for producing the enzyme. BACKGROUND ART [0002] L-Glutamate oxidase is an enzyme which catalyzes the following reaction: L-glutamic acid+O2+H2O→α-ketoglutaric acid+H2O2+NH3. [0003] The known species of L-Glutamate oxidase include those obtained through isolation and purification from Streptomyces sp. X-119-6, Streptomyces violascens, and Streptomyces endus [0004] (Agric. Biol. Chem., 47, 1323-1328 (1983), Chem. Pharm. Bull., 31, 1307-1314 (1983), Chem. Pharm. Bull., 31, 3609-3616 (1983), Eur. J. Biochem., 182, 327-332 (1989)). [0005] These L-glutamate oxidases have the following characteristics in common: (1) being produced from microorganisms belonging to genus Streptomyces; (2) remarkably high substrate specificity to L-glutamic acid; (3) comparatively stable under variations in temperature and pH; and (4) being a flavin enzyme requiring FAD as a coenzyme. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N9/06C07H21/04C12P21/06C12N1/21C12N15/53
CPCC12Y104/03011C12N9/0022
Inventor INAGAKI, KENJIARIMA, JIROASHIUCHI, MAKOTOYAGI, TOSHIHARUKUSAKABE, HITOSHI
Owner YAMASA SHOYU CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com