Polypeptide for inhibition of angiogenesis and method for preparing same and use thereof
An angiogenesis and multipurpose technology, applied in the field of bioengineering, can solve the problems of increased difficulty in drug quality control, high dosage, and limited effect, and achieve the effects of specifically inhibiting endothelial cell proliferation, reducing side effects, and improving efficacy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Cloning of EDSM-1 gene and EDSM-2 and construction of prokaryotic expression vector:
[0037] The endostatin gene was taken as a template; an upstream primer and a downstream primer were synthesized, wherein the upstream primer added an NdeI restriction site; the downstream primer contained an Arg-Gly-Asp sequence and an XhoI site. PCR amplification was carried out, the amplified product was recovered and purified by agarose gel electrophoresis, digested with NdeI and XhoI, and cloned into the prokaryotic expression vector PET-23a, positive clones were screened by PCR, and the nucleotide sequence analysis confirmed that the sequence was designed mutation.
[0038] Synthetic primer 1: 5'GGAATTCCATATGTTC CAG CCG GTG CTC CAC CTG GTT 3'Synthetic primer 2:
[0039] 5' CCGCTCGAG ATCACCTCG CACCACCACCACCGGCGCGGAAGGTGCCCGCCAG3'
[0040] Synthetic Primer 3:
[0041] 5'CCGCTCGAGGCAGAAGCAGTCACCACGGCAGTCGCATGCACCACCACCACCGGCGCGGAAGGTGCCCGCCAG3'
[0042] Among them, primer 1 enco...
Embodiment 2
[0049] Anti-lung cancer experiment in animals
[0050] The cultured mouse Lewis lung cancer cells were digested with 0.05% trypsin, centrifuged at 1000rpm for 5min, resuspended in PBS, and subcutaneously inoculated 5×10 5 Cells 0.1ml. When the average tumor volume reaches 200mm 3 -300mm 3 , the mice were randomly divided into groups, 7 in each group, one group was treated with EDSM-1, and the other group was treated with endostatin. Treatment is by subcutaneous injection on the contralateral side of tumor inoculation. Measure the tumor size with a vernier caliper every day, and calculate the tumor volume, using the formula: tumor volume = length × width 2 ×0.52, the therapeutic effect is represented by the tumor inhibition rate within a given time: (1-T / C)×100%, T=tumor volume of the treatment group, C=tumor volume of the control group.
[0051] The results showed that on the 9th day, the tumor inhibition rate of EDSM-1 was 79%, while that of endostatin was 53% (P<0.05 fo...
Embodiment 3
[0054] Tumor inhibitory effect of HAC liver cancer model in mice
[0055] The cultured mouse HAC liver cancer cell line was digested with 0.05% trypsin, centrifuged at 1000rpm for 5min, resuspended in PBS, and subcutaneously inoculated 5×10 5 Cells 0.1ml. When the average tumor volume reaches 200mm 3 -300mm 3 , the mice were randomly divided into groups, 7 in each group, and treated by subcutaneous injection on the opposite side of the tumor inoculation. Measure the tumor size with a vernier caliper every day, and calculate the tumor volume, using the formula: tumor volume = length × width 2 ×0.52, the therapeutic effect is represented by the tumor inhibition rate within a given time: (1-T / C)×100%, T=tumor volume of the treatment group, C=tumor volume of the control group.
[0056] Divided into negative control group (distilled water), positive control group (endostatin) and EDSM-1, EDSM-2 treatment groups for research, subcutaneous injection administration, the results sh...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com