Bacterial speices and method for producing succinic acid by microbial fermentation
A technology of microbial fermentation and succinic acid, which is applied in the field of bioengineering, can solve the problems of unsuitable industrial production, high requirements for culture and fermentation conditions, and difficulty in obtaining strains, and achieves the effect of alleviating the shortage of petrochemical resources and being environmentally friendly.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0030] Sampling was taken from the fresh rumen of cattle that had just been slaughtered in a beef cattle slaughterhouse in Wuxi City, and the digested matter in the rumen was taken and inoculated into a triangular flask filled with 80 mL of rich medium containing sodium fumarate, and cultured anaerobically at 37°C for about 36- After 48 hours, two more enrichments were carried out according to the inoculum size of 10%. Dilute the enriched culture with PBS (0.145mol / L sodium chloride, 0.01mol / L sodium phosphate aqueous solution) and spread it on the selective plate of the plate screening medium with sodium fumarate as the only carbon source, and culture 48h. Select the colony with a larger transparent circle, inoculate it into a test tube containing 5 mL of fermentation medium, and culture it anaerobically for 36 h. The supernatant was determined by the TCL method, and 72 colonies similar to succinic acid spots were selected out of 160 colonies.
[0031] Among them: enrichmen...
Embodiment 2
[0035] The retained strains were transferred to a test tube containing 5 mL of the above-mentioned fermentation medium, and cultured anaerobically at 37° C. for 36 h. Take 5mL of the culture solution and transfer it to a conical flask containing 80ml of the same fermentation medium, add sterilized calcium carbonate, control the pH to 6.5, and culture it anaerobically at 37°C for 48 hours, filter it, and measure the supernatant by HPLC The content of succinic acid in the liquid. Most of the strains had high lactic acid content, and only No. II-80 (laboratory number SW0580) produced succinic acid significantly.
[0036]
Embodiment 3
[0038] The physiological and biochemical characteristics of the screened SW0580 strain were identified according to the "Bergey's Bacteria Identification Manual (Eighth Edition)" (see Table 2), and the chromosomal DNA was extracted according to the method of the refined molecular biology experiment guide, with Y1 and Y2 as the Forward and reverse primers (Y1: ATTGAACGCTGGCGGCAGGC, Y2: CGGGCGGTGTGTACAAGGCC) were used to amplify the 16S rRNA gene by PCR, and Shanghai Shennengbo Biotechnology Co., Ltd. was commissioned to perform 16S rDNA sequencing. The 16S rRNA gene sequences of related strains in GenBank were searched by BLAST on the website, and the homology comparison was performed (Table 3). Based on the 16S rDNA sequence analysis and the identification of physiological and biochemical characteristics, combined with the study of the growth and fermentation characteristics of the bacteria, compared with the closest (or highest homology) strain Actinobacillus succinogenes ATCC...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com