Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chitinase gene of pea bean and its amino-acid squence of coded product

A technology of chitinase gene and amino acid, applied in the new gene field, can solve the problem of less research on bean chitinase gene and the like

Inactive Publication Date: 2005-03-23
HARBIN NORMAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, most of the chitinase genes are isolated from corn, rice, and tobacco, and there are few studies on the chitinase genes of kidney bean
And although the chitinase genes isolated in recent years have shown certain anti-fungal disease ability in transformed plants, it is still necessary to isolate chitinase genes with stronger anti-fungal disease ability.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chitinase gene of pea bean and its amino-acid squence of coded product

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0074] The bean chitinase gene Bchi of the present invention is obtained by PCR amplification using the total DNA of the bean variety Wuchang oil bean as a template. The prokaryotic expression of the gene was detected, and the plant expression vector of the gene was constructed and transformed into tobacco. The endochitinase activity and anti-fungal ability of the transgenic plants were tested. The specific method is as follows:

[0075] 1. Cloning of kidney bean chitinase gene

[0076] (1) Design of PCR primers

[0077] According to the sequence of kidney bean mRNA recorded in GenBank, a pair of primers for PCR amplification was designed by using the software Primer Primer5.0. The sequences are as follows:

[0078] P1 (5' end primer): 5'GG GGATCC AGAGAATGAAGAAGAATAGG 3′

[0079] BamHI

[0080] P2 (3' end primer): 5'GG GAGCTC ATTTATTGATAGATGGTGGG3′

[0081] SacI

[0082] (2) Extraction of the total DNA of the kidney bean genome:

[0083] About 100 mg of the young le...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a bean chitinase gene and the aminophenol sequence of its coded product, relating to a new gene sequence. It has a registered number AY357300 in GenBank, 1088bp long, where T, C, G and A are 232 (21.3%), 330 (30.3), 276 (25.4%) and 276 (23.0%), respectively, there is a starting codon ATG at 7bp site, there is a terminating codon TGA at 988bp site, and there is a poly (A) additional signal at 1008bp and 1082bp sites, respectively. It has no intron but complete 981bp-long open code read frame, coding 327 aminophenols. Its coded product has molecular weight of 35.3kD and equipotential point pI at 7.93. The invention separates a chitinase gene from bean genome, enlarges plant anti-fungal disease gene resources, thus providing richer excellent gene candidates for gene engineering of resisting plant diseases and insect pests and improving plant variety.

Description

Technical field: [0001] The present invention relates to a novel gene. Background technique: [0002] In recent years, fungal diseases have caused great harm to crops, so it is of great significance to prevent and control fungal diseases by means of genetic engineering. Since one of the cell wall components of many pathogenic fungi that harm plants is chitin, and no substrate for chitinase has been found in plants, chitinase plays an important role in defending against pathogenic fungi and is a plant defense important part of the system. Therefore, the isolation and transformation of chitinase gene has become a research hotspot in crop anti-fungal disease genetic engineering. [0003] The research on plant chitinase gene started in 1986. In 1986, Broglie et al. isolated the chitinase gene from kidney bean, with a reading frame of 984 nucleotides and encoding 328 amino acids. In 1991, Zhu et al. used the broad bean chitinase gene fragment as a probe to isolate the entire ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/24C12N15/56
Inventor 徐香玲王全伟李集临李新玲闫玉清张延明徐淑红
Owner HARBIN NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products