Chitinase gene of pea bean and its amino-acid squence of coded product
A technology of chitinase gene and amino acid, applied in the new gene field, can solve the problem of less research on bean chitinase gene and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0074] The bean chitinase gene Bchi of the present invention is obtained by PCR amplification using the total DNA of the bean variety Wuchang oil bean as a template. The prokaryotic expression of the gene was detected, and the plant expression vector of the gene was constructed and transformed into tobacco. The endochitinase activity and anti-fungal ability of the transgenic plants were tested. The specific method is as follows:
[0075] 1. Cloning of kidney bean chitinase gene
[0076] (1) Design of PCR primers
[0077] According to the sequence of kidney bean mRNA recorded in GenBank, a pair of primers for PCR amplification was designed by using the software Primer Primer5.0. The sequences are as follows:
[0078] P1 (5' end primer): 5'GG GGATCC AGAGAATGAAGAAGAATAGG 3′
[0079] BamHI
[0080] P2 (3' end primer): 5'GG GAGCTC ATTTATTGATAGATGGTGGG3′
[0081] SacI
[0082] (2) Extraction of the total DNA of the kidney bean genome:
[0083] About 100 mg of the young le...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap