Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Paddy rice stalk extension gene, coded protein and application thereof

A rice and protein technology, applied in the field of botany, can solve the problems of genes related to the rapid growth of plants that have not been disclosed

Inactive Publication Date: 2005-01-19
SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
View PDF0 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, no genes related to rapid plant growth have been disclosed so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Paddy rice stalk extension gene, coded protein and application thereof
  • Paddy rice stalk extension gene, coded protein and application thereof
  • Paddy rice stalk extension gene, coded protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Cloning of rice stem elongation protein gene

[0083] Utilize the rice gene positioning cloning (map-based cloning or positioncloning) population that comprises the stem elongation protein gene Eui and its mutant gene eui that the inventor constructs, and those skilled in the art are clear, locate Eui / eui according to the molecular marker Within a small genome fragment, such as within 30kb. On this basis, a genomic DNA clone containing the fragment was isolated by a conventional method. It was identified by enzyme digestion and further hybridization that one of them contained the stem elongation protein Eui gene of the whole rice.

[0084] The result of the whole nucleotide sequence analysis shows that the full length of the rice stem elongation gene is 5900bp (SEQ ID NO: 1, including the regulatory region and the intron). According to software analysis and cDNA cloning, its ORF is shown in SEQ ID NO: 2, and it encodes rice stem elongation protein with a full length o...

Embodiment 2

[0089] Obtaining the Coding Sequence of Rice Stem Elongation Protein by RT-PCR

[0090] In order to verify the correctness of the sequence, according to the sequence of SEQ ID NO: 1, the following primers were designed and synthesized:

[0091] Forward primer 5'-3'ACGGAGGCCCATGAGCAAATTTCAA (SEQ ID NO: 4)

[0092] Reverse primer 5'-3' ACGTATCAGAGCCAGTCACAGCTTGG (SEQ ID NO: 5).

[0093] Correspondingly, in order to obtain the cDNA probe of the stem elongation protein gene, the following primers were designed and synthesized:

[0094] Forward primer 5'-3'ACCAGCGTCATCTTCAGCA (SEQ ID NO: 6)

[0095] Reverse primer 5'-3'AACGTCTCCCGCACCAC (SEQ ID NO: 7)

[0096] A 500bp cDNA probe was amplified by RT-PCR.

[0097] Rice Poly A extracted by conventional methods + RNA was used as a template for RT-PCR amplification. The amplification conditions were 94°C for 5 minutes, followed by 35 cycles of 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute, and finally extended at ...

Embodiment 3

[0099] Structural Analysis of Rice Stem Elongation Protein

[0100] According to the nucleotide sequence of cDNA (SEQ ID NO: 2), the sequence of the encoded stem elongation protein (SEQ ID NO: 3) was obtained. According to online query of protein database, stem elongation protein contains highly conserved cytochrome P450 domain. Therefore, it is concluded that the stem elongation protein is a P450 monooxygenase.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a novel plant gene, i.e. rice stalk lengthening gene, its encoding protein and promotor, the invention also provides the use of the gene, in particular the use for transforming plant stalk extensibility and antisenescence in vegetation improvement and crossbreeding.

Description

technical field [0001] The invention belongs to the field of botany. Specifically, the invention relates to a novel rice (Oryza sativa) stem elongation gene, its encoded protein and its promoter. The invention also discloses the application of the coding stem elongation gene, especially for changing the stem elongation and anti-aging properties of plants in plant growth improvement and hybrid breeding. Background technique [0002] The rapid growth of plants plays a very important role in crops, forestry production and resistance to adverse climatic conditions including drought, water shortage, floods, low temperature, etc. It is also a good model for studying plant cell differentiation, hormone regulation, and molecular physiology. [0003] However, no genes related to rapid plant growth have been disclosed so far. Therefore, in order to effectively and specifically change the rapid growth of plant varieties, there is an urgent need in this field to develop proteins relate...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A01H1/00C07K14/415C12N15/11C12N15/29C12N15/63C12P21/00
Inventor 何祖华李群许永汉朱永友林鸿宣周海臣毛碧增
Owner SHANGHAI INST OF BIOLOGICAL SCI CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com