Production of agartose -4, 6
A manufacturing method, a new technology of agar oligosaccharides, applied in the field of agar oligosaccharides, can solve the problems of poor specificity, high price, low activity, etc., and achieve the effect of mild conditions, low cost, and short action time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0007] 1 Construction of Escherichia coli recombinant strain DH5α-pET24-agaA capable of highly expressing agarase
[0008] The upstream primer (5'GGAATTCCATATGAAAGGATTCACTAAG3') and the downstream primer (5'CCGCTCGAGCTGGAATTTAAAACGTTG3') were designed according to the complete sequence of the agarase gene agaA, the total DNA of Pseudomonas CY24 was used as a template, and the complete agarase gene was amplified by PCR. sequence. The PCR conditions were as follows: pre-denaturation at 94°C for 3 minutes, followed by 30 cycles of 94°C for 30s, 60°C for 30s, and 72°C for 60s, and finally extension at 72°C for 10 minutes. Agarose electrophoresis showed a specific band at 1.36kb, which was excised from the agarose gel and ligated with the Escherichia coli expression vector pET-24a(+), and the ligated product was transferred into In Escherichia coli E. coli DH5α, transformants having ampicillin resistance were selected. The plasmid was extracted by a standard alkaline lysis method...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com