Construction and expression of recombinant human B cell stimulating factor (rhBLyS) expression vector, and monoclonal antibody preparation and use
A monoclonal antibody and stimulatory factor technology, applied in the fields of application, antibody, recombinant DNA technology, etc., can solve problems such as difficulties in developing antibodies
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1, the acquisition of hBLyS cDNA
[0027] Peripheral blood lymphocytes from healthy people were isolated, activated by adding phytohamagglutinin (PHA) 1 μg / ml and phorbol 12-myristate 13-acetate (PMA) 10 ng / ml, and cultured at 37°C for 8 hours, then the cultured cells were collected. Total RNA was extracted according to the one-step method of guanidine isothiohydrogen, and quantified by ultraviolet spectrophotometer. According to the full-length hBLyS gene sequence, a pair of primers were designed and synthesized,
[0028] P15 `GTCGAATTCATGGATGACTCCACAG3`,
[0029] P25 `CACGTCGACTCACAGCAGTTTCAATG3`,
[0030] The 5' end primer contains an EcoR I restriction site and a start codon, and the 3' end primer contains a Sal I restriction site and a termination codon. Using the extracted total RNA as a template, the first strand of cDNA was synthesized by reverse transcription, and then amplified by conventional PCR. The amplification conditions were: denaturation ...
Embodiment 2
[0031]The PCR amplification product of hBLyS gene was double-digested by EcoR I and Sal I, and inserted into the EcoR I and Sal I double-digestion window of pGEX-4T-1 to obtain a recombinant plasmid containing the GST-hBLyS fusion protein gene. The construction process was as follows: Figure 2 shows. Transform Escherichia coli BL21 with the recombinant plasmid, then spread the Escherichia coli BL21 on the LB plate containing ampicillin, overnight at 37°C, and observe that pGEX-4T-1 / hBLyS plasmid transformed bacteria are evenly distributed on the plate on the next day, respectively. After the pGEX-4T-1 / hBLyS and pGEX-4T-1 plasmid transformed bacteria were amplified, the plasmid DNA was extracted for enzyme digestion and identification. After 1.0% agarose gel electrophoresis, it can be seen that EcoR I and Sal I double enzymes After cleavage, two fragments were obtained, namely pGEX-4T-1 of about 4.9kb and hBLyS gene fragment of about 858bp, which were consistent with the theore...
Embodiment 3
[0031]The PCR amplification product of hBLyS gene was double-digested by EcoR I and Sal I, and inserted into the EcoR I and Sal I double-digestion window of pGEX-4T-1 to obtain a recombinant plasmid containing the GST-hBLyS fusion protein gene. The construction process was as follows: Figure 2 shows. Transform Escherichia coli BL21 with the recombinant plasmid, then spread the Escherichia coli BL21 on the LB plate containing ampicillin, overnight at 37°C, and observe that pGEX-4T-1 / hBLyS plasmid transformed bacteria are evenly distributed on the plate on the next day, respectively. After the pGEX-4T-1 / hBLyS and pGEX-4T-1 plasmid transformed bacteria were amplified, the plasmid DNA was extracted for enzyme digestion and identification. After 1.0% agarose gel electrophoresis, it can be seen that EcoR I and Sal I double enzymes After cleavage, two fragments were obtained, namely pGEX-4T-1 of about 4.9kb and hBLyS gene fragment of about 858bp, which were consistent with the theore...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap