Application of lettuce LsSAW1 gene in controlling heading character of lettuce
A gene and technology of lettuce, applied in the field of lettuce LsSAW1 gene and its application in controlling lettuce heading traits, can solve problems such as unclear regulatory network
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] The acquisition of lettuce head gene LsSAW1:
[0024] 1. Genetic Analysis of Heading Traits of Lettuce
[0025] In order to analyze the genetic rule of lettuce heading traits, the present invention adopts head lettuce (PI536839) and non-heading lettuce (PI344074) to obtain F. 1 Generation Hybrid, F 1 Generation hybrids are selfed to obtain F 2 Generation groups (Yu et al. 2020). to F 2 Statistical analysis of the heading phenotype was carried out for each individual in the generation group, and the heading trait showed a continuous distribution from "tight head" to "loose head", and then to "no head", which proved that the head characteristic of lettuce was a Quantitative traits controlled by polygenes.
[0026] Using BSA combined with RNA-seq method to analyze F 2 The nodularity of the population was genetically analyzed. in F 2 In the isolated population, 20 individuals with good nodulation were selected to construct a "balling pool", and 20 non-balling indivi...
Embodiment 2
[0031] Application of head gene LsSAW1 in lettuce head:
[0032](1) Using non-heading lettuce (PI344074) as a template, using primers: AGH601F: atggaagtagccagattccaa and AGH672R: ctaactgaaaaaagacgtttt, the amplified target fragment is the sequence shown in SEQ ID NO.1, which is inserted by the method of homologous recombination into the pRI101 plant expression vector (vector linearized with EcoRI) and transformed head lettuce under Agrobacterium tumefaciens. Using transgenic detection primers: M13F: gtaaaacgacggccagt; AGH607R: cgtcgctaattcttaattcc to detect transgenic plants, a total of 3 transgenic plants were obtained, and all 3 transgenic plants showed a non-heading phenotype ( image 3 Middle (a) left second shows the phenotype of one of the transgenic plants, LsSAW1-OX#1). T for one of the transgenic lines 1 The head phenotype and genotype analysis showed that the individual plants with transgene insertion showed no head phenotype, while the individual plants without tr...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com