Rare genetic disease mutant gene and application thereof
A technology for mutated genes and genetic diseases, applied in the field of mutated genes for rare genetic diseases and its applications, can solve the problems of GL-3 degradation blockage, α-GalA enzyme function loss, ischemia, etc., and achieve the effect of reducing the birth of children
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1 - Mutated Genes for Rare Inherited Diseases
[0018] Rare genetic disease mutated genes, the specific mutations are shown in Table 1 below:
[0019] Table 1 Specific detection results of mutated genes in rare genetic diseases
[0020] Gene genomic location transcript number base change amino acid changes Reference Genome Version exon number GLA chrX:100656741 NM_000169 c.426C>A p.Cys142Ter GRCh37 / hg19 Exon3
[0021] (1) At genomic position chrX:100656692-chrX:100656791, the sequence of the wild-type GLA gene is:
[0022] is the base of the wild-type GLA gene at chrX:100656741 in the genome.
[0023] At the corresponding genome position, the sequence of the rare genetic disease mutation gene is:
[0024] is the base of the mutant gene GLA at chrX:100656741 in the genome.
[0025] (2) When the transcript number is NM_000169, the reference sequence of the DNA encoding the wild-type GLA gene is:
[0026] ...
Embodiment 2
[0032] Example 2-Detection kit for rare genetic disease mutation gene
[0033] Detection kits for mutation genes of rare genetic diseases, including Taq DNA polymerase, PCR buffer and primers, etc. The specific primers are as follows:
[0034] Upstream primer (GLA-E16F, SEQ ID NO: 1): 5'CTGCTACCTCACGATTGTGCT 3';
[0035] Downstream primer (GLA-E16R, SEQ ID NO:2): 5'ACCTGGACTCCCCTAA 3';
[0036] Length: 532bp.
[0037] The specific steps of using this kit to screen the mutated pathogenic gene GLA are as follows: extract the DNA of the test subject, and then use the designed primer combination (SEQ ID NO: 1 and SEQ ID NO: 2) to amplify the GLA gene to obtain For the PCR product, use 1.5% agarose gel electrophoresis to detect the PCR product, select 1000bp Marker as a reference, check and verify that the amplified product is the expected size, and finally sequence the PCR product. Obtained reference sequences from the NCBI (https: / / www.ncbi.nlm.nih.gov / ) database and compared...
Embodiment 3
[0038] Embodiment 3-family verification experiment
[0039] In this example, the method of family linkage analysis is used to verify the pathogenicity of mutant genes of rare genetic diseases.
[0040] Specifically, three generations of members of a family with familial Fabry disease were selected, and the proband (female, 57 years old) in this family was clinically diagnosed with Fabry disease.
[0041] On the premise that the proband and his family members voluntarily sign the informed consent, 5-10mL whole blood samples will be sent, and a medical record database will be established to record the proband's condition and family status in detail. This study has been approved by the institutional ethics committee.
[0042] Description of the clinical profile of the proband:
[0043] Table 3 Clinical profile of the proband
[0044]
[0045] The GLA gene of the proband and his family members was tested using the in vitro detection kit provided in Example 2, and the results...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap