Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

miRNA molecule related to pig antral follicle atresia and application of miRNA molecule

A follicular atresia and molecular technology, applied in the field of miRNA and its application, can solve the problem of low ovulation rate and achieve the effect of promoting apoptosis of granulosa cells, strong specificity, and short sequence

Pending Publication Date: 2021-12-21
JINLING INST OF TECH
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, during growth and development and the estrous cycle, a large number of follicles atresia and disappear before reaching a diameter of 6 mm, resulting in a final achievable ovulation rate of less than 14%

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • miRNA molecule related to pig antral follicle atresia and application of miRNA molecule
  • miRNA molecule related to pig antral follicle atresia and application of miRNA molecule
  • miRNA molecule related to pig antral follicle atresia and application of miRNA molecule

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Expression difference of porcine miR-9820-5p in healthy and atretic antral follicles

[0045] (1) Design of porcine miR-9820-5p primers

[0046] According to the sequence of sus-miR-9820-5p (NR_128505.1), primers were designed; the specific sequence is as follows:

[0047] Reverse transcription primer SEQ ID No.2: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCCTTTC;

[0048] The specific forward primer sequence of miR-9820-5p is SEQ ID No.3: GCCGAGGAGGAGGAGGGAA;

[0049] The forward primer sequence of U6 is SEQ ID No.8: CGCTTCGGCAGCACATATAC;

[0050] U6 reverse primer sequence SEQ ID No.9: TTCACGAATTTGCGTGTCAT;

[0051] The reverse universal primer sequence SEQ ID No.10 for miRNA amplification: CTCAACTGGTGTCGTGGA;

[0052] The above primers were synthesized by a primer synthesis company, wherein U6 is an internal reference gene.

[0053] (2) RNA extraction of pig healthy antral follicles (conventional TRIZOL method):

[0054] Healthy pre-estrus pig ovaries were taken, an...

Embodiment 2

[0062] Cellular localization of porcine miR-9820-5p

[0063] (1) Design of porcine miR-9820-5p fluorescent probe

[0064] According to the principle of complementary pairing, a digoxigenin-labeled probe for miR-9820-5p was designed. The sequence of the probe is shown in SEQ ID NO:4. The probe was synthesized by Probe Synthesis Company.

[0065] (2) Scale culture of porcine granulosa cells

[0066] Pig ovaries were washed with sterile saline containing gentamicin (80 mg / L), and follicular fluid and granulosa cells were extracted from transparent antral follicles with a diameter of about 5 mm using a syringe with a 20-gauge needle. Then culture porcine granule cells in DMEM / F12 medium (purchased from Gibco, USA) containing 10% fetal bovine serum (FBS), 100 units / mL penicillin and 100 mg / mL streptomycin, and the cells were seeded on coverslips. In a six-well plate, the incubator conditions were 37 °C and 5% CO2. After the cells adhere to the wall, the coverslip can be remove...

Embodiment 3

[0073] miR-9820-5p promotes apoptosis of porcine granulosa cells

[0074] (1) Design of miR-9820-5p-specific mimics and inhibitors

[0075] Using the miR-9820-5p sequence as a template, it was synthesized by a synthetic company. The sequence pairs of miR-9820-5p-specific mimics are respectively SEQ ID NO:5 and SEQ ID NO:6; the sequences of miR-9820-5p-specific inhibiror are respectively SEQ ID NO:7.

[0076] (2) Transfection of porcine granulosa cells miR-9820-5p

[0077] Porcine granulosa cells were cultured for 36 hours and transfected when the cells reached 50-80% confluency. LipofectamineTM3000 transfection reagent and Opti MEM medium (purchased from Invitrogen) were used for transfection according to the instruction manual. Experiments were performed in three biological replicates.

[0078] (3) Detection of miR-9820-5p specific mimics and inhibitory efficiency

[0079] Using porcine granulosa cell cDNA transfected with miR-9820-5p-specific mimics, miR-9820-5p-specifi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of livestock molecular biology, and particularly relates to microRNA (miRNA) related to pig antral follicle atresia and an application of the microRNA. The miRNA is miR-9820-5p, and the linear nucleotide sequence of the miRNA is as shown in SEQ ID NO: 1. According to the invention, a specific hybridization probe is designed aiming at the miR-9820-5p, and real existence of the miR-9820-5p is verified through fluorescence in situ hybridization. Specific amplification primers are designed for the miR-9820-5p, it is detected through fluorescent quantitative PCR that the expression of the miR-9820-5p in healthy cavity follicle tissues in pig ovaries is lower than that of atresia follicles, and treatment with corresponding analogues and inhibitors proves that the miR-9820-5p has a remarkable promoting effect on granular cell apoptosis. Besides, the invention provides nucleotide sequences of an miR-9820-5 analogue and an miR-9820-5 inhibitor respectively. The miR-9820-5p disclosed by the invention is expected to be used as a molecular marker related to sow reproduction, and provides a new theoretical basis and a potential molecular target for evaluation of porcine reproduction traits, improvement of reproductive capacity and occurrence and prevention of human follicular abnormality related diseases.

Description

technical field [0001] The invention belongs to the technical field of livestock molecular biology, and in particular relates to a miRNA related to pig antral follicle atresia and application thereof. Background technique [0002] The reproductive performance of female animals, especially litter size, is closely related to the number of eggs ovulated. Follicular atresia is a natural physiological phenomenon during the development of mammalian follicles. Before and after birth, a sow's primordial follicle cavity forms, and its follicular reserve contains approximately 5 million primordial follicles. However, during growth and development and the estrous cycle, a large number of follicles atresia and disappear before reaching a diameter of 6 mm, resulting in a final achievable ovulation rate of less than 14%. As a major component of the follicle, granulosa cells function by intimately interacting with oocytes and theca cells and producing paracrine substances. Studies have ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12N15/113C12N15/11
CPCC12Q1/6888C12N15/113C12Q2600/178C12Q2600/124
Inventor 张金璧徐世永茅慧华刘京鸽陈清
Owner JINLING INST OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com