Breeding method for obtaining XX/XY sex-determined pseudo male fish parents on large scale and application thereof
A technology of false male fish and sex, which is applied in the field of breeding of pseudo male fish parents, can solve problems such as unstable sex development of broodstock, water pollution, fish residues, etc., to achieve quantitative expansion and simple screening, improve production efficiency, The effect of lowering the level
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0066] Embodiment 1 of the present invention provides a breeding method for large-scale obtaining XX / XY sex-determined pseudo-male parents, comprising the following steps:
[0067] S1, obtaining the cyp17a1 gene edited injection mixture, and injecting it into the embryo of the fish, using the gene editing technology to knock out the cyp17a1 gene in the fish, and obtaining the F0 generation;
[0068] S11, by using the online tool http: / / zifit.partners.org / ZiFiT / Disclaimer.aspx to find the cyp17a1 gene editing target site, the gene target site is located on exon 1 of the cyp17a1 gene, divided into the first target site and The second target site, the sequences of the aforementioned two are respectively TGGCTTTTCTGTTCATGCC and CCAAGCCTCCCATCACTCCC (such as SEQ ID NO.1, SEQ ID NO.2 and figure 2 shown in the sequence marked in);
[0069] S12, design corresponding primers according to the fish cyp17a1 gene editing target site (as shown in Table 1, the sequence of the forward prime...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap