Application of polypeptide PTPR in preparation of tumor immunotherapy medicine
An immunotherapy drug and tumor technology, applied in the field of biomedicine, can solve the problems of reducing the effect of immunotherapy, inactivation of tumor immune response, etc., to achieve the effect of inhibiting drug resistance, reducing abundance, and promoting tumor immune escape
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1, PTPR peptide functional verification at the cellular level
[0035] 1. TMUB1 small molecule RNA inhibitor
[0036]According to the TMUB1 gene nucleotide sequence (Gene ID: 83590, http: / / sidirect2.rnai.jp / , the nucleotide sequence is shown in SEQ ID NO.2, the amino acid sequence is shown in SEQ ID NO.3), according to Based on the principle of complementary base pairing and the principle of minimum energy, two cholesterol-modified small molecule RNA nucleotide sequences are obtained, namely TMUB1 sequence 1 and TMUB1 sequence 2, which are TMUB1 small molecule RNA inhibitors.
[0037] TMUB1基因序列(SEQ ID NO.2):atga ccctgattgaaggggtgggt gatgaggtgaccgtcctttt ctcggtgctt gcctgccttc tggtgctggcccttgcctgg gtctcaacgc acaccgctgagggcggggac ccactgcccc agccgtcagggaccccaacg ccatcccagc ccagcgcagc catggcagctaccgacagca tgagaggggaggccccaggg gcagagaccc ccagcctgag acacagaggt caagctgcacagccagagcccagcacgggg ttcacagcaa caccgccagc cccggactcc ccgcaggagcccctcgtgctacggctgaaa ttcctcaatg attc...
Embodiment 2
[0053] Example 2. Design of TMUB1-competitive polypeptide PTPR and its entry into cells and its effect on PD-L1 expression.
[0054] 1. Using the principle of competitive inhibition to design TMUB1 competitive polypeptide PTPR
[0055] (1) Construction of TMUB1 truncated protein carrying Flag tag
[0056] TMUB1 protein (Wild Type) amino acid sequence composition ( image 3 Middle A): The 11th to 31st bits are TM1, the 32nd to 102nd bits are MU1, the 103rd to 176th bits are UBL, the 177th to 194th, 216th to 221st, and 242nd to 246th bits are MU2, the 195th to 215th bits are TM2, and the 222nd to 241st bits are TM3.
[0057] In view of the important regulatory role of TMUB1 protein (Wild Type) on the stability of PD-L1 and the characteristics of the amino acid sequence, we truncated part of the amino acid sequence in TMUB1 protein (Wild Type), as follows:
[0058] The nucleotide sequences translated MU1, UBL, MU2, and TM1 in TMUB1 were respectively truncated to obtain TMUB1 n...
Embodiment 3
[0068] Example 3. Using FITC-PTPR to weaken the immune escape of tumor cells to enhance the killing of tumor cells by T cells
[0069] Given the inhibitory effect of FITC-PTPR on PD-L1 stability at the cellular level, FITC-PTPR should have a significant inhibitory effect on tumor immune escape.
[0070] Human peripheral blood mononuclear cell PBMC were purchased from the American Standard Cell Culture Center (ATCC), using RMPI-1640 medium (Gibco) containing 10% FBS (Bovogen), 37 ° C, 5% CO 2 Cultured in an incubator, the MycoAlert kit (Lonza) detected that the cells had no mycoplasma contamination and no cross-contamination.
[0071] According to the instruction manual of human CD3 / CD28 / CD2 T cell activator (STEMCELL Technologies), PBMC were activated into cytotoxic T cells. The human breast cancer cell line MDA-MB-231 was inoculated into a 6-well plate with 3ml of FBS (Bovogen) DMEM / F12 medium containing 10% volume concentration in an amount of 2*10^5, 37°C, 5% CO 2 After ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com