Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of controllable release electrochemical DNA hydrogel composite material based on double-strand specific nuclease assistance

A composite material and hydrogel technology, applied in the field of biosensing, can solve problems such as tubal infertility, and achieve excellent response rate and sensitivity

Pending Publication Date: 2021-11-26
THE FIRST AFFILIATED HOSPITAL OF XIAMEN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

More importantly, although there are no obvious symptoms, it can cause serious sequelae such as pelvic inflammatory disease and tubal infertility

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of controllable release electrochemical DNA hydrogel composite material based on double-strand specific nuclease assistance
  • Preparation method of controllable release electrochemical DNA hydrogel composite material based on double-strand specific nuclease assistance

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Based on the preparation method of DSN-assisted controlled release electrochemical DNA hydrogel composite material, the steps are as follows:

[0028] (1) Mix SA or SB with 25% mass fraction of acrylamide solution, and vacuum dry for 15 minutes to remove oxygen. Then 10% mass fraction of freshly prepared APS and 10% mass fraction of TEMED were added and dried at 37 °C for 60 min to form P-SA or P-SB. Then, P-SA, P-SB, NE buffer and HRP were mixed and heated at 65 °C for 10 min with vigorous shaking to form a DNA hydrogel.

[0029] (2) DNA sequence in step (1) SA: Acrydite-AAAAACTTAGGGGCCGA C TAACCC, SB: Acrydite-AAAAGGGTTA C TCGGCC. During the synthesis of polymer P-SA or P-SB, the volume ratio of adding SA or SB, acrylamide solution, APS and TEMED is 80 μL: 16 μL: 1 μL: 1 μL. During the heating process of the DNA hydrogel composite material, the volume ratio of P-SA, P-SB, NE buffer and HRP is 2.5 μL: 2.5 μL: 1 μL: 1 μL. The unit of HRP enzyme activity is 100 M U. ...

Embodiment 2

[0031] Based on the DSN-assisted controllable release electrochemical DNA hydrogel composite material prepared in Example 1, the detection steps of target RNA are as follows:

[0032](1) Mix 20 μl target rRNA sequence or 20 μl blank buffer with 1 μl DSN respectively, and then add them to the DNA hydrogel prepared in step (1) of Example 1 to form a mixture. After incubating the mixture at 35°C for 60 minutes, shake it gently, take out 10 μl of supernatant, add it dropwise to the activated gold electrodes, and let it stand to dry. And take 10 μl of blank buffer solution and add it dropwise on the activated gold electrode, and let it stand to dry, as a blank control.

[0033] (2) In step (1), the target rRNA sequence is GGGUUAGUCGGCCCCUAAGU, the concentration is 10 pM, and the unit of DSN enzyme activity is 10 M U. The blank buffer is 1×PBS buffer.

[0034] (3) Immerse the gold electrodes prepared in step (1) into 1 ml TMB substrate solution (K-blue, Neogencorporation, containi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a preparation method of a controllable release electrochemical DNA hydrogel composite material based on double-strand specific nuclease assistance. The method is characterized by comprising the following steps of designing base sequences of a DNA chain A (SA) and a DNA chain B (SB) in the DNA hydrogel. Under the assistance of double-strand specific nuclease (DSN), more obvious response can be generated to the stimulation of a small amount of chlamydia trachomatis 16S rRNA (target RNA); in most types of DNA hydrogels, each separation of a DNA probe requires one target chain to hybridize thereto; and when the quantity of target rRNA is less, the target rRNAcannot generate effective stimulation on the DNA hydrogel. According to the method, DSN is successfully introduced into the DNA hydrogel, and the controlled-release DNA hydrogel which can be repeatedly split by a small amount of target objects is obtained, so that the controlled-release DNA hydrogel has higher reaction rate and sensitivity.

Description

technical field [0001] The invention relates to a preparation method of a double-strand specific nuclease (DSN)-assisted controllable release electrochemical DNA hydrogel composite material and its application to the electrochemical detection of Chlamydia trachomatis 16S rRNA, belonging to the field of biosensing. Background technique [0002] Controlled release systems can change their physicochemical properties in response to specific stimuli, such as nucleic acids, light, molecules, etc. A large number of controlled-release systems constructed based on hydrogels have been designed and widely used in smart drug delivery and targeted cancer therapy due to their excellent loading capacity and stimuli responsiveness. Recently, controlled release systems have been combined with multiple detection technologies to develop bioanalytical sensors for different targets. Electrochemical detection technology is a qualitative and quantitative detection technology based on the electroc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N27/327C08F220/60C08F220/56
CPCG01N27/3276G01N27/3277C08F220/60C08F220/603C08F220/56Y02A50/30
Inventor 洪国粦程玲军何颖豪刘银环杨园园林振宇
Owner THE FIRST AFFILIATED HOSPITAL OF XIAMEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com