Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Medicine for treating ketamine addiction

A technology of ketamine and drugs, applied in the field of anti-addiction drugs, can solve the problems of lack of drugs for treating addiction, easy addiction of ketamine, no Mgll and ketamine addiction, etc., achieve good industrial prospects and public value, reduce Effects of Ketamine Addiction

Active Publication Date: 2021-11-02
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The use of ketamine is prone to addiction, endangers health, and even breeds social security problems, so the country is tough on it
But even so, the illicit abuse of ketamine has not been solved, and one of the key reasons is the lack of drugs to treat addiction
There is no report on the relationship between Mgll and ketamine addiction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Medicine for treating ketamine addiction
  • Medicine for treating ketamine addiction
  • Medicine for treating ketamine addiction

Examples

Experimental program
Comparison scheme
Effect test

experiment example 1

[0030] Experimental Example 1 Construction of AAV-Mg11 (adeno-associated virus overexpressing Mg11) of the present invention

[0031] 1. Preparation of recombinant vector

[0032] (1) Carrier information:

[0033] Plasmid name: H7286

[0034] Gene name: Mgll, monoacylglycerol lipase

[0035] Gene species: Mus musculus

[0036] Gene length: 912bp

[0037] Basic scheme: annealing, enzyme digestion and ligation

[0038] (2) Materials and methods

[0039] 1. Instruments and equipment

[0040]

[0041] 2. Experimental reagents

[0042]

[0043] 3. Experimental method

[0044] (1) Design and synthesize the overexpression sequence (SEQ ID NO.1) according to the target gene Mg11 as follows:

[0045] atgcctgaggcaagttcacccaggcgaactccacagaatgttccctaccaggacctgcctcacctggtcaatgcagacggacagtacctcttttgtagatactggaagcccagtggcacacccaaggccctcatctttgtgtcccatggagctggggaacactgtggccgttatgatgagctggctcatatgttgaaggggctggacatgctggtatttgcccatgaccatgttggccatgggcagagtgagggagagaggatggtggtgtcgga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a medicine for treating ketamine addiction, and belongs to the field of anti-addiction medicines. The invention discloses a medicine for treating ketamine addiction. The medicine takes a substance for improving the expression of a Mgll gene as an active ingredient. The invention provides an effective solution for ketamine addiction, and has good industrial prospect and public benefit value.

Description

technical field [0001] The invention belongs to the field of anti-addiction drugs. Background technique [0002] Ketamine, whose chemical name is 2-(2-chlorophenyl)-2-(methylamino)cyclohexanone, is commonly used in its hydrochloride form and is a white crystalline powder. Ketamine was first used as a non-barbiturate intravenous anesthetic, which has hypnotic and analgesic effects. It is mainly used clinically for anesthesia induction and auxiliary anesthesia in minor operations, pediatric examinations, or diagnostic operations. Immediately after the intravenous or intramuscular injection, the human body appears confused, like falling into a dream, but can still open the eyes, the muscle tension increases and becomes numb, and it is no longer sensitive to changes in the surrounding environment, but the pain sensation completely disappears, and consciousness and sensation are separated. In 1971, San Francisco and Los Angeles first reported cases of ketamine abuse. Since then...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K48/00A61P25/36
CPCA61K48/005A61K48/0008A61K9/0019A61P25/36
Inventor 岑小波徐薇
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com