A fox retrovirus sybr Green Ⅰ fluorescent RT-PCR kit and its application method
A technology of RT-PCR and retrovirus, which is applied in the field of fox retrovirus SYBRGreenⅠ fluorescent RT-PCR kit, can solve the problems such as the lack of fox retrovirus SYBRGreenⅠ fluorescent RT-PCR detection kit, and achieve good application prospects, Strong specificity, stable and reliable results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Example 1 Establishment of the detection method of fox retrovirus SYBR Green I fluorescent RT-PCR
[0035] 1. Primer design and synthesis
[0036] According to the fox retrovirus POL gene sequence measured in the previous research of our laboratory, after sequence comparison, select the conserved region to design amplification primers, the primers are 3 pairs, and the sequences are as follows:
[0037] First pair of primers:
[0038] SEQ ID No. 1: upstream primer ACCTGGGACTACGACACTG,
[0039] SEQ ID No. 2: downstream primer CCTGCTGGCGTCTCATCT;
[0040] Second pair of primers:
[0041]SEQ ID No. 5: upstream primer CGGGTGGTCCCGACCTG,
[0042] SEQ ID No.6: downstream primer GTCTCATCTTTCCCCCTGC;
[0043] The third pair of primers:
[0044] SEQ ID No. 7: upstream primer CAAAGGTACGTGCTATAGTG,
[0045] SEQ ID No. 8: downstream primer CTCTAACTTATTACAAATAC;
[0046] The above primer set was synthesized by Universal Biosystems (Anhui) Co., Ltd.
[0047] 2. Preparation of...
Embodiment 2
[0071] Example 2 Sensitivity analysis of the kit
[0072] The test was performed using the kit provided in Example 1.
[0073] (1) Prepare pMD-POL standard solution, calculate the copy number according to the concentration of pMD-POL plasmid standard, and the copy number of pMD-POL plasmid is 3.2×10 10 copies / μL;
[0074] The plasmid standard was serially diluted in a 10-fold ratio, taking 10 6 Copy / μL~10 -1 Copy / μL of pMD-POL plasmid standard is used as plasmid standard template, and the obtained template solutions are numbered as follows:
[0075] Standard template 1: 3.2×10 6 copies / μL of pMD-POL plasmid standard;
[0076] Standard Template 2: 3.2×10 5 copies / μL of pMD-POL plasmid standard;
[0077] Standard Template 3: 3.2×10 4 copies / μL of pMD-POL plasmid standard;
[0078] Standard Template 4: 3.2×10 3 copies / μL of pMD-POL plasmid standard;
[0079] Standard Template 5: 3.2×10 2 copies / μL of pMD-POL plasmid standard;
[0080] Standard Template 6: 3.2×10 1 c...
Embodiment 3
[0088] Example 3 Kit specific analysis
[0089](1) Prepare the template: use plasmid pMD-POL, canine distemper virus, fox parvovirus, infectious hepatitis virus, Escherichia coli, Pasteurella, and Staphylococcus genomes as templates, and nuclease-free water as a control, ready to use;
[0090] (2) Fluorescence RT-PCR amplification: The total fluorescence RT-PCR system is 20 μL: 10 μL of 2×Onestep TB Green RT-PCR Buffer III, 1 μL of enzyme mixture, 2 μL of primer set, 6 μL of nuclease-free water, and added to a 0.1 mL amplification tube , prepare 8 copies, set aside; marked as 1#, 2#, 3#, 4#, 5#, 6#, 7#, 8# for use;
[0091] The plasmid pMD-POL, canine distemper virus, fox parvovirus, infectious hepatitis virus, Escherichia coli, Pasteurella, and Staphylococcus in step (1) were added to 1#, 2#, 3#, 4#, 5 #, 6#, 7#, add nuclease-free water to 8#, after adding the sample, centrifuge briefly, and place it in a fluorescence PCR instrument for amplification reaction;
[0092] Fluo...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com