Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A fox retrovirus sybr Green Ⅰ fluorescent RT-PCR kit and its application method

A technology of RT-PCR and retrovirus, which is applied in the field of fox retrovirus SYBRGreenⅠ fluorescent RT-PCR kit, can solve the problems such as the lack of fox retrovirus SYBRGreenⅠ fluorescent RT-PCR detection kit, and achieve good application prospects, Strong specificity, stable and reliable results

Active Publication Date: 2022-05-24
SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is no detection method for any fox retrovirus at home and abroad, and there is no fox retrovirus SYBRGreen I fluorescent RT-PCR detection kit. Therefore, the research of the present invention has great significance for the detection of fox retrovirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A fox retrovirus sybr Green Ⅰ fluorescent RT-PCR kit and its application method
  • A fox retrovirus sybr Green Ⅰ fluorescent RT-PCR kit and its application method
  • A fox retrovirus sybr Green Ⅰ fluorescent RT-PCR kit and its application method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Establishment of the detection method of fox retrovirus SYBR Green I fluorescent RT-PCR

[0035] 1. Primer design and synthesis

[0036] According to the fox retrovirus POL gene sequence measured in the previous research of our laboratory, after sequence comparison, select the conserved region to design amplification primers, the primers are 3 pairs, and the sequences are as follows:

[0037] First pair of primers:

[0038] SEQ ID No. 1: upstream primer ACCTGGGACTACGACACTG,

[0039] SEQ ID No. 2: downstream primer CCTGCTGGCGTCTCATCT;

[0040] Second pair of primers:

[0041]SEQ ID No. 5: upstream primer CGGGTGGTCCCGACCTG,

[0042] SEQ ID No.6: downstream primer GTCTCATCTTTCCCCCTGC;

[0043] The third pair of primers:

[0044] SEQ ID No. 7: upstream primer CAAAGGTACGTGCTATAGTG,

[0045] SEQ ID No. 8: downstream primer CTCTAACTTATTACAAATAC;

[0046] The above primer set was synthesized by Universal Biosystems (Anhui) Co., Ltd.

[0047] 2. Preparation of...

Embodiment 2

[0071] Example 2 Sensitivity analysis of the kit

[0072] The test was performed using the kit provided in Example 1.

[0073] (1) Prepare pMD-POL standard solution, calculate the copy number according to the concentration of pMD-POL plasmid standard, and the copy number of pMD-POL plasmid is 3.2×10 10 copies / μL;

[0074] The plasmid standard was serially diluted in a 10-fold ratio, taking 10 6 Copy / μL~10 -1 Copy / μL of pMD-POL plasmid standard is used as plasmid standard template, and the obtained template solutions are numbered as follows:

[0075] Standard template 1: 3.2×10 6 copies / μL of pMD-POL plasmid standard;

[0076] Standard Template 2: 3.2×10 5 copies / μL of pMD-POL plasmid standard;

[0077] Standard Template 3: 3.2×10 4 copies / μL of pMD-POL plasmid standard;

[0078] Standard Template 4: 3.2×10 3 copies / μL of pMD-POL plasmid standard;

[0079] Standard Template 5: 3.2×10 2 copies / μL of pMD-POL plasmid standard;

[0080] Standard Template 6: 3.2×10 1 c...

Embodiment 3

[0088] Example 3 Kit specific analysis

[0089](1) Prepare the template: use plasmid pMD-POL, canine distemper virus, fox parvovirus, infectious hepatitis virus, Escherichia coli, Pasteurella, and Staphylococcus genomes as templates, and nuclease-free water as a control, ready to use;

[0090] (2) Fluorescence RT-PCR amplification: The total fluorescence RT-PCR system is 20 μL: 10 μL of 2×Onestep TB Green RT-PCR Buffer III, 1 μL of enzyme mixture, 2 μL of primer set, 6 μL of nuclease-free water, and added to a 0.1 mL amplification tube , prepare 8 copies, set aside; marked as 1#, 2#, 3#, 4#, 5#, 6#, 7#, 8# for use;

[0091] The plasmid pMD-POL, canine distemper virus, fox parvovirus, infectious hepatitis virus, Escherichia coli, Pasteurella, and Staphylococcus in step (1) were added to 1#, 2#, 3#, 4#, 5 #, 6#, 7#, add nuclease-free water to 8#, after adding the sample, centrifuge briefly, and place it in a fluorescence PCR instrument for amplification reaction;

[0092] Fluo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a fox retrovirus SYBR Green I fluorescent RT-PCR kit and its use method. The kit includes a nucleic acid releasing agent, 2×One step TB Green RT-PCR Buffer III, an enzyme mixture, a negative control, a positive control and A primer set; the nucleotide sequence of the primer set is the specific base sequence shown in SEQ ID No.1 and SEQ ID No.2; the method of use includes preparing a sample template to be tested, fluorescent RT-PCR amplification and result analysis. The detection primers are used in the SYBR GreenⅠ fluorescent RT-PCR kit, so that the kit has the advantages of wide applicability and strong applicability, as well as the advantages of high detection accuracy and strong specificity; in addition, using the The kit can complete the detection of fox retrovirus by adding one sample, and the detection process is simple and easy to operate.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a fox retrovirus SYBR Green I fluorescent RT-PCR kit and a method of use. Background technique [0002] Fox retrovirus can cause serious diseases in foxes. The clinical manifestations are slow growth of foxes, increased feed-to-meat ratio, severe immunosuppression and reduced resistance, etc., which are easily secondary to other diseases, resulting in high mortality. The disease is a new disease that seriously affects the economic benefits of fox breeding in recent years, causing serious economic losses to the fox breeding industry. [0003] Early and rapid detection of the virus is the key to preventing and controlling the disease. However, in the current literature, there are very few records and reports about this retrovirus. Virus isolation and culture operations are cumbersome and difficult to isolate successfully. In order to monitor the clinical occurrence ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686C12Q1/6806C12R1/93
CPCC12Q1/702C12Q1/686C12Q1/6806C12Q2563/107C12Q2545/113C12Q2523/32C12Q2527/125
Inventor 王玉茂于新友韩强付石军郭广君庄金秋王建军沈志强
Owner SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More