Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Cas12 protein, gene editing system containing Cas12 protein and application thereof

A technology of cas12j-8 and protein, which is applied in the field of gene editing system and Cas12 protein, can solve problems such as difficult wide application, easy off-target, complex PAM sequence, etc.

Pending Publication Date: 2021-09-10
FUDAN UNIV
View PDF7 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these Cas9s are either easy to off-target (that is, cut at non-target sites), or have complex PAM sequences, or have low editing activity, making it difficult to be widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas12 protein, gene editing system containing Cas12 protein and application thereof
  • Cas12 protein, gene editing system containing Cas12 protein and application thereof
  • Cas12 protein, gene editing system containing Cas12 protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0328] (1) Construction of plasmid pAAV2_Cas12_ITR

[0329] According to the gene retrieval number of each Cas12 protein listed in Table 1, download its amino acid sequence, wherein the amino acid sequences of Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein and ChCas12b protein are respectively as SEQ ID NO: 1 To SEQ ID NO:6 shown.

[0330] Table 1. Cas12 protein and its NCBI protein search ID and sequence number

[0331] Cas12 protein name NCBI Protein Search ID amino acid sequence Cas12J-8 none SEQ ID NO: 1 Mb4Cas12a WP_078273923.1 SEQ ID NO: 2 MlCas12a WP_065256572.1 SEQ ID NO: 3 MoCas12a WP_112744621.1 SEQ ID NO: 4 BgCas12a OLA11341.1 SEQ ID NO: 5 ChCas12b OQB30769 SEQ ID NO: 6

[0332] The coding nucleic acid sequences of the above Cas12 proteins were codon-optimized to obtain the gene sequences of the highly expressed Cas12 proteins in human cells. The opti...

Embodiment 2

[0411] (1) Construction of plasmid pAAV2_Cas12_ITR

[0412] According to the gene retrieval number of each Cas12 protein listed in Table 1 above, download its amino acid sequence information, wherein the amino acid sequences of Cas12J-8 protein, Mb4Cas12a protein, M1Cas12a protein, MoCas12a protein, BgCas12a protein and ChCas12b protein are respectively as SEQ ID NO: 1 to SEQ ID NO: 6.

[0413] Codon optimization was carried out on the coding nucleic acid sequence of the Cas12 protein obtained above to obtain the gene sequence of the Cas protein highly expressed in human cells. The gene sequences of Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein protein and ChCas12b are respectively shown in SEQ ID NO: 8 to SEQ ID NO: 13.

[0414] The highly expressed gene sequences of the Cas proteins obtained above from SEQ ID NO: 8 to SEQ ID NO: 13 were gene synthesized and constructed on the slugCas9 backbone plasmid (Addgene platform, catalog #1...

Embodiment 3

[0477] (1) Preparation of linearized plasmid SlugABEmax

[0478] Use the SlugABEmax plasmid (Addgene platform, catalog#163798) as a template for PCR reaction, and the primer sequence is:

[0479] Primer 1: TCTGGTGGTTTCTCCCAAGAAGA

[0480] Primer 2: TGACCCCCCGCTGCTGCCCC

[0481] The reaction system is as follows:

[0482]

[0483]

[0484] The PCR running procedure is as follows:

[0485]

[0486] The PCR product was electrophoresed on a 1% agarose gel at 120V for 30 min, and a gel recovery kit was used to purify the 4152bp DNA fragment according to the steps provided by the manufacturer. TM Lite spectrophotometer (ThermoScientific) was used to measure the DNA concentration, which was stored for later use or placed at -20°C for long-term storage.

[0487] (2) Preparation of plasmid pAAV2_envTadA-Cas12J-8ITR

[0488] Homologous recombination was performed on the linearized SlugABEmax backbone fragment and the humanized Cas12J-8 fragment (SEQ ID NO: 8) synthesized ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene editing, and particularly relates to a CRISPR / Cas12 gene editing system and application thereof. The gene editing system is a complex formed by specific Cas12 protein and sgRNA, and can accurately locate a targeted DNA sequence and cut the targeted DNA sequence, thereby causing double-chain fracture damage on the target sequence; and the gene editing is carried out in cells or in vitro. The specific Cas12J-8 protein has a relatively small number of amino acids; the specific Cas12J-8 protein, the Cas12a protein and the Cas12b protein all have high editing efficiency; and PAM sequences recognized by the three types of proteins are all very simple. The method has a wide application prospect in the field of gene editing.

Description

technical field [0001] This application belongs to the technical field of gene editing, and specifically relates to Cas12 protein, a gene editing system containing the Cas12 protein and related applications. Background technique [0002] The CRISPR / Cas system is an adaptive immune system evolved by bacteria and archaea to resist the invasion of foreign viruses or plasmids. In the CRISPR / Cas12a and CRISPR / Cas12j systems, crRNA (CRISPR-derived RNA) and Cas12 protein form a complex to recognize the PAM (Protospacer Adjacent Motif) sequence of the target site. After recognition, crRNA will form a complementary structure with the targeted DNA sequence, and the Cas protein will perform the function of cutting DNA, resulting in DNA breakage and damage. The CRISPR / Cas12b system also contains tracrRNA (trans-activating RNA), which forms a complex with crRNA and Cas12b to function. tracrRNA and crRNA can be fused into a single-stranded single-stranded guide RNA (single guide RNA, sg...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/22C12N9/78C12N15/62C12N15/113C12N15/864C12N5/10
CPCC12N9/22C12N9/78C12N15/113C12N15/86C12N5/0686C12Y305/04002C07K2319/00C12N2310/20C12N2750/14143C12N2800/22C12N2800/107C12N2510/00
Inventor 王永明王帅高思琪王瑶
Owner FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com