Cas12 protein, gene editing system containing Cas12 protein and application thereof
A technology of cas12j-8 and protein, which is applied in the field of gene editing system and Cas12 protein, can solve problems such as difficult wide application, easy off-target, complex PAM sequence, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0328] (1) Construction of plasmid pAAV2_Cas12_ITR
[0329] According to the gene retrieval number of each Cas12 protein listed in Table 1, download its amino acid sequence, wherein the amino acid sequences of Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein and ChCas12b protein are respectively as SEQ ID NO: 1 To SEQ ID NO:6 shown.
[0330] Table 1. Cas12 protein and its NCBI protein search ID and sequence number
[0331] Cas12 protein name NCBI Protein Search ID amino acid sequence Cas12J-8 none SEQ ID NO: 1 Mb4Cas12a WP_078273923.1 SEQ ID NO: 2 MlCas12a WP_065256572.1 SEQ ID NO: 3 MoCas12a WP_112744621.1 SEQ ID NO: 4 BgCas12a OLA11341.1 SEQ ID NO: 5 ChCas12b OQB30769 SEQ ID NO: 6
[0332] The coding nucleic acid sequences of the above Cas12 proteins were codon-optimized to obtain the gene sequences of the highly expressed Cas12 proteins in human cells. The opti...
Embodiment 2
[0411] (1) Construction of plasmid pAAV2_Cas12_ITR
[0412] According to the gene retrieval number of each Cas12 protein listed in Table 1 above, download its amino acid sequence information, wherein the amino acid sequences of Cas12J-8 protein, Mb4Cas12a protein, M1Cas12a protein, MoCas12a protein, BgCas12a protein and ChCas12b protein are respectively as SEQ ID NO: 1 to SEQ ID NO: 6.
[0413] Codon optimization was carried out on the coding nucleic acid sequence of the Cas12 protein obtained above to obtain the gene sequence of the Cas protein highly expressed in human cells. The gene sequences of Cas12J-8 protein, Mb4Cas12a protein, MlCas12a protein, MoCas12a protein, BgCas12a protein protein and ChCas12b are respectively shown in SEQ ID NO: 8 to SEQ ID NO: 13.
[0414] The highly expressed gene sequences of the Cas proteins obtained above from SEQ ID NO: 8 to SEQ ID NO: 13 were gene synthesized and constructed on the slugCas9 backbone plasmid (Addgene platform, catalog #1...
Embodiment 3
[0477] (1) Preparation of linearized plasmid SlugABEmax
[0478] Use the SlugABEmax plasmid (Addgene platform, catalog#163798) as a template for PCR reaction, and the primer sequence is:
[0479] Primer 1: TCTGGTGGTTTCTCCCAAGAAGA
[0480] Primer 2: TGACCCCCCGCTGCTGCCCC
[0481] The reaction system is as follows:
[0482]
[0483]
[0484] The PCR running procedure is as follows:
[0485]
[0486] The PCR product was electrophoresed on a 1% agarose gel at 120V for 30 min, and a gel recovery kit was used to purify the 4152bp DNA fragment according to the steps provided by the manufacturer. TM Lite spectrophotometer (ThermoScientific) was used to measure the DNA concentration, which was stored for later use or placed at -20°C for long-term storage.
[0487] (2) Preparation of plasmid pAAV2_envTadA-Cas12J-8ITR
[0488] Homologous recombination was performed on the linearized SlugABEmax backbone fragment and the humanized Cas12J-8 fragment (SEQ ID NO: 8) synthesized ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com