Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Probe for intramolecular amplification of nucleic acid and detection method thereof

A technology for nucleic acid molecules and detection methods, which is applied in biochemical equipment and methods, microbial measurement/testing, DNA/RNA fragments, etc., to achieve high specificity, good replication accuracy, and low input costs

Active Publication Date: 2022-06-21
HUNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The technical problem to be solved by the present invention is to solve the deficiencies existing in the existing nucleic acid amplification technology, provide a probe and detection method for nucleic acid intramolecular amplification, and effectively reduce the false positives caused by the existing nucleic acid amplification question

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe for intramolecular amplification of nucleic acid and detection method thereof
  • Probe for intramolecular amplification of nucleic acid and detection method thereof
  • Probe for intramolecular amplification of nucleic acid and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1. The feasibility of the verification method and the correctness of its principle

[0058] In this example, the probe sequence containing the five regions (5')a-b-a-c-a*(3') described in the content of the invention was designed and synthesized directly by the company, and the nucleic acid intramolecular amplification reaction ( figure 1 ), the feasibility of the method and the correctness of the principle are verified by three methods: fluorescence signal verification method, electrophoresis result verification method and atomic force microscope result verification method. The sequence of the probe synthesized in this example is (AGAGGTAGTACTAGTACTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGT ACTACCTCT, namely SEQ ID NO. 1). At the same time, the control sequence 1 and the control sequence 2 of the probe were also synthesized. Sequence 1 is that the a* nucleotide sequence at the 3' end is replaced by other nucleotide sequences; the control sequence 2 (the ...

Embodiment 2

[0068] Influence of nucleic acid melting reagents on nucleic acid intramolecular amplification reaction system Since nucleic acid melting reagents have the effect of promoting the dynamic dissociation of nucleic acids, making double-stranded nucleotides into single-stranded nucleotides, first, in order to verify the effect of betaine on the present invention Whether there is a promoting effect, in this example, betaine of different concentrations was added to verify, and a probe (sequence: AGAGGTAGTACTAGTACTCAAGAGGTAGTACTAGTAAGTTGCCTTCAGAACTCTACTACTACTAGTAC TACCTCT, i.e. SEQID NO.1) was used to carry out intramolecular nucleic acid amplification. Specific steps are as follows:

[0069] 1) To prepare 23uL of reaction solution, except that betaine is not added, other components are the same as the basic reaction solution. Add 400 nmol / L probe to the prepared reaction solution.

[0070] 2) Take 2ul betaine and add it to the reaction solution configured in step 1), and configure ...

Embodiment 3

[0076] In this example, a probe is formed from a probe precursor, and a colorimetric method of nucleic acid intramolecular amplification is used to detect whether the sample to be tested contains a specific DNA target nucleic acid (taking the DNA virus Boca virus as an example).

[0077]This example uses the boca virus probe precursor (sequence: GCCGGCAGACTTTACTTTTTTTTTTTTTTGCCGGCAGACTCCAATATGTCTGCCGGC, namely SEQ ID NO. 4), boca virus sample 1 (sequence: GCCGGCAGACATATTGGATTCCAAGATGGCGTCTGTACAACC, namely SEQ ID NO. 5), boca virus control sequence sample 2 ( AGCTGCAGATGAGTTGGATTGGAAGAACCCGTGTGTTGTACA, ie SEQ ID NO. 6). Blank control sample 3 (with water instead of detecting nucleic acid sequences) was tested for the ability to detect DNA target nucleic acids by colorimetry.

[0078] Specific steps are as follows:

[0079] 1) prepare 23uL of basic reaction solution, add 2.5umol / L calcein green, 1.5mmol / L manganese chloride, and 400nmol / L boca virus probe precursor;

[0080] 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A nucleic acid intramolecular amplification probe and detection method, the nucleic acid intramolecular amplification probe of the present invention contains at least five regions (5')a-b-a-c-a*(3'), Contains two identical a-regions, one at the 5' end and one in the middle; b-region is connected to two a-regions, one of a-region is connected at the 5' end to the 5' end of b-region, and the other a-region is connected to c-region The 5' end of the c region is connected to the 5' end of the a* region, and the a* region is the complementary nucleotide sequence of the a region and is at the 3' end of the probe; under the action of the polymerase, the probe takes itself as Templates and primers for intramolecular amplification of nucleic acids. In the invention, the template and the primer are designed in one molecule, and the same template is used to realize intramolecular amplification of the nucleic acid, effectively avoiding the problem of false positives. The present invention also includes a method for detecting target nucleic acid using probes and probe precursors. The method can detect single base difference, has strong anti-interference ability, and has broad market prospect.

Description

technical field [0001] The invention belongs to a nucleic acid amplification method in the technical field of molecular biology, and in particular relates to a probe for intramolecular amplification of nucleic acid and a detection method. Background technique [0002] Today, molecular diagnosis and detection technology with nucleic acid amplification as the core has become a hot spot in academia and industry. At present, a series of nucleic acid amplification technologies have been developed one after another. These technologies can be divided into two types according to whether precise temperature control is required. The first type is variable temperature amplification, mainly including polymerase chain reaction (PCR) and ligase chain reaction (LCR) temperature-controlled amplification. In these amplification methods, the number of newly synthesized sequences is increased by repeated thermal cycling, but requires special and relatively expensive thermal cycling equipment....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/6848
CPCC12Q1/6848C12Q2527/125C12Q2525/301C12Q2531/119C12Q2563/107
Inventor 孟祥贤蓝琳刘孟坛刘志强
Owner HUNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com