Construction method of human CD55 transgenic large animal
A construction method and animal technology, applied in the fields of botanical equipment and methods, biochemical equipment and methods, genetic engineering, etc., can solve the problems of declining animal health, inappropriate insertion sites of foreign genes, animal death, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0256] Example 1, Preparation of Transgenic Pigs Highly Expressing Human Complement Regulatory Protein CD55
[0257] Use single-stranded guide RNA (single guide RNA, sgRNA) to design sgRNA (sgRNA: gctccttctcgattatgggc) that specifically recognizes the target sequence DNA at the safe harbor Rosa26 site in the pig genome, and connect it into the pX458 vector recovered by Bbs I digestion to construct Rosa26 Target knockout vectors. Synthesize the CDS (Coding sequence) sequence (Gene ID: NM_000574) of the human (Homo sapiens) complement regulatory protein CD55 (Cluster of differentiation 55), and construct Rosa26 with about 800 bp homology arms on both sides by means of Overlap PCR and TA cloning Target site-directed integration vector.
[0258] According to different linearization methods, the carrier for linearization in vivo is the HMEJ site-directed integration vector ( figure 1 ), and contains the Hyg resistance gene; the in vitro linearized vector is the Tild-CRISPR site-d...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com