Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Anti-HIV-1 P24 recombinant antibody

A CDR-VH2 and CDR-VH1 technology, applied in the field of immunity, can solve the problems of large loss of activity, large amount of monoclonal antibody used, false positive of HIV antibody, etc., and achieve the effect of high affinity and strong binding protein activity

Active Publication Date: 2021-07-16
DONGGUAN PENGZHI BIOTECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the determination of serum HIV antibody is a routine experimental method for diagnosing HIV infection, but the determination of HIV antibody has limitations: more than 70% of HIV-infected people can detect antibodies after 6 months of infection, and in the homosexual group, this number exceeds 80% %, the method of detecting antibodies increases the risk of HIV transmission in the "window period"; in addition, it takes one year after birth for newborns to produce antibodies, and HIV antibodies from the mother will cause false positives; due to the persistence of HIV antibodies in the course of the disease, only It disappears in the late stage of AIDS and cannot be used as a stable indicator for treatment monitoring
At present, the double-antibody sandwich method is commonly used to detect human immunodeficiency virus P24 antigen, which has good specificity, but simply using physical adsorption to absorb monoclonal antibodies or polyclonal antibodies on the microtiter plate will cause a large amount of monoclonal antibody usage and low activity. big loss
Traditional clinical diagnosis uses mouse-derived monoclonal antibodies. The sensitivity and specificity of existing antibodies against HIV-1 P24 antigen are not ideal enough, and there are not many options. Therefore, the market is for high activity and high affinity HIV-1 p24 monoclonal antibodies are in strong demand

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-HIV-1 P24 recombinant antibody
  • Anti-HIV-1 P24 recombinant antibody
  • Anti-HIV-1 P24 recombinant antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0132] This embodiment provides an exemplary preparation method of a recombinant antibody against HIV-1 p24.

[0133] S1. Construction of expression plasmid:

[0134] In this example, the resolved endonuclease is resolved, and the Prime Star DNA polymerase is purchased from TAKARA.

[0135] MagextRactor-RNA extraction kit purchased from ToyoBO; BD Smart TM Race CDNAMPLification Kit kit purchases from Takara;

[0136] PMD-18T vectors are purchased from Takara;

[0137] Plasmid extraction kits were purchased from the mean company;

[0138] Primer synthesis and gene sequencing were completed by Invitrogen.

[0139] S11, the design and synthesis of primers:

[0140] Amplify the top of the 5'race of the heavy chain and light chain:

[0141] Smarter II A Oligonucleotide:

[0142] 5 '> AAGCAGTGTATCAACGCAGAGTACXXXXX <3';

[0143] 5'-Race CDS Primer (5'-CDS): 5 '> (t) 25 VN <3 '(n = a, c, g, ort; v = a, g, orc);

[0144] Universal Primer A Mix (UPM):

[0145] 5 '> CTaatacgactCactataGgcaagc...

Embodiment 2

[0180] Antibody affinity analysis and activity identification

[0181] The antibody (WT) obtained in Example 1 was analyzed having a sequence such as a light chain as shown in SEQ ID NO: 11, and a heavy chain shown in 12.

[0182] After analysis, the complementary decision area of ​​the heavy chain:

[0183] CDR-VH1 is D-S (x1) -S-F-T-P (X2) -Y-T-I (X3) -H;

[0184] CDR-VH2 is I-N-P-Y-N-Q (X1) -T-S-S (X2) -Q-K-F-Q (X3) -G;

[0185] CDR-VH3 is A-R-R (X1) -G-Y-D-R-E-G-Q (x2) -Y-Y-P (X3) -M-D-Y-F (x4) -g;

[0186] Light chain complementary determining area:

[0187] CDR-VL1 is N (X1) -A-S-E-Q (X2) -i-Y-T-F-I (X3) -A;

[0188] CDR-VL2 is T-S (X1) -K-T-I (X2) -A-E;

[0189]CDR-VL3 is Q-H-H-Y-G-L (X1) -P-I (X2) -T-W (x3) -g;

[0190] Among them, X1, X2, X3, X4 are all standby deactivation sites.

[0191] After analysis, the mutant site associated with antibody activity in the above CDR is as follows:

[0192] Table 1 Mutant site associated with antibody activity

[0193]

[0194] The ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel separated binding protein containing an HIV-1 P24 antigen binding domain, and researches on the aspects of preparation, application and the like of the binding protein. The binding protein comprises at least one complementarity determining region, is high in activity, has very high affinity with HIV-1 P24 protein, and can be widely applied to the field of detection of the HIV-1 P24 protein.

Description

Technical field [0001] The present invention relates to the field of immunization, and in particular, to a recombinant antibody against HIV-1 p24. Background technique [0002] Human Immunodeficiency Virus; ABBR: HIV, ie AIDS (AIDS, Getting Immunode Defect Syndrome) virus is a virus that causes human immune system defects. In 1981, human immunodeficiency viruses were first discovered in the United States. It is a slow virus that is infected with human immune system cells and is a kind of retrovirus. At present, AIDS has not only become a public health issue that seriously threatens my country's health, but has affected economic development and social stability. [0003] HIV is a pathogen of AIDS, mainly by sexual contact, blood and maternal and baby. In recent years, the number of patients with HIV infection has been in terms of rise. According to the Ministry of Health, China has found the first AIDS patient since 1985, as of the end of October 2009, accumulated 319,877 cases of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K16/10G01N33/569
CPCC07K16/1054G01N33/56988C07K2317/565C07K2317/92G01N2469/10
Inventor 崔鹏何志强孟媛钟冬梅姜瑢瑢梁碧游辉马秋燕李蔚芝
Owner DONGGUAN PENGZHI BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com