Application of linc00167 in the preparation of drugs for inhibiting tumor angiogenesis
An angiogenesis and drug technology, applied in the field of biomedicine, can solve the problems of tumor angiogenesis and negative impact on the prognosis of radiotherapy patients, so as to reduce the probability of recurrence and improve the prognosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] (1) The present invention passes a bio-experimental technique, screened a long-chain non-coding RNA: LINC00167, which is up-regulated after irradiation, has a nucleotide sequence as follows:
[0030]attttgggtgggactaagcaaagacgaaacaccctcccagtctatggggtagtctggaccctggcttatctggttcccttaatcctttaggtacttacacgacgttgggtgaggggagctggaagatcagcgggtccccgatcctctctccctaggggtgatagaaatcaaccccccccgccacctccaggtggttcttcccgccgcagagtgggagcagcataaaaggcggggtcttattagcataatctgcctggcaacctgatctcgacgttatatgattggttaaactctgtaagccccatgccgtgcctagagacgagaaacgctggggcgaactgacaggcccagatttaggagtcatgacgaagatcctgagacgcttattcagtctgcagagaagccaaaaggagattcacataatggcccaatgactgaaggcctctttatttcgtgctctgctgttcgtgtaaaacccaatcgcagagcgggtctcaggcggcgctcgcctgcgtttctactctcagccaatcagaaaacccgactcttcgcattggggtcaagcccccgctgcggcccgcgtgctaacggggaggaagcttccagctgtgcctgggtgtctcgggcgccgagggcagcctgcgcccgtgctaagcccgcctcccgcgcgcccgagggcccggtgtcccggaagacgcgcgggggtgaggcggccctcgcgtccgcccgccccgccacagattgcctccgaagtggcctggccgtggagcgccggcgaaaaccgaactc...
Embodiment 2
[0034] Example 2 Impact of Irradiation on LINC00167 Expression
[0035] (1) Cell culture
[0036] The stable lung cancer cell line A549 cells were selected, cultured with RPMI-1640, placed at 37 ° C constant temperature, 5% CO 2 Culture in the cell incubator; first in sterile PBS in a sterile PBS in a sterile PBS, then use 0.25% trypsin to digest 1-2 min, and after the cells are digestion from the culture dish, 10% fetal bovine serum is used. The RPMI-1640 complete medium retained; in a new dish, the RPMI-1640 fully medium solution was added to expand the culture.
[0037] (2) Irradiation treatment
[0038] The cultured A549 cells was divided into control group and experimental group, with about 1 × 10 per group. 8 A cells; electrical energy excitation X-ray irradiation instrument (Model RAD · SOURCE, RS-2000) using biological experiments, the voltage is 50kV, the dose rate is 1.224Gy / min, the experimental group accepts 2GY X-rays Ignor, the control group was not irradiated; the...
Embodiment 3
[0049] Example 3 Vascular formation experiment
[0050] The A549 cell culture was cultured in a 6-well plate, which was brought to 60% -70%, and X-ray irradiation was performed. The dose was 2 Gy, and after irradiation at 37 ° C, 5% CO 2 Take 24 h under conditions, the medium of A549 cell culture medium, cultured HUVEC cells, observed the conditions of the conditions of the irradiation group and the non-irradiated group on the level of HUVEC cytotropic formation.
[0051] The day before the experiment, MATRIGEL (Corning 354234-9148009) was placed in 4 ° C melting. Sterilization 200 μL gun, 1ml gun head, and 96-well plate refrigeration. When the experiment is started, MATRIGEL has been placed on ice or ice box, ensuring that the Matrigel concentration is greater than or equal to 10 mg / ml, evenly ground in a pre-cooling 96-well plate, 100 μL per well. The entire petri dish was placed in an incubator and put it 30 min to solidify the glue. In the process of waiting for the glue, ta...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com