Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting Hantaan-type hantavirus and detection method thereof

A hantavirus and detection method technology, applied in the field of medical biology, can solve the problems of only qualitative, low sensitivity, and quantitative detection, and achieve improved accuracy and variability, good sensitivity and accuracy, and high detection sensitivity Effect

Inactive Publication Date: 2021-06-18
CHINESE ACAD OF INSPECTION & QUARANTINE
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Immunofluorescence assay (IFA) is the recommended monitoring method for hantavirus in host animals in the current monitoring scheme. Immunoassay has high sensitivity, simple operation, and is suitable for high-throughput detection, which is convenient for daily clinical detection and large-scale serological epidemiological investigation, but it is insufficient for the determination of Hantavirus type; colloidal gold method is simple, Cheap and other advantages, suitable for grassroots units and on-site detection, but low sensitivity, only qualitative, not quantitative detection; RT-PCR method, with the advantages of high specificity and high sensitivity, can be used for quantitative detection and type judgment , but its analysis results are heavily dependent on the cycle threshold (Ct value), and cannot accurately detect low-abundance samples

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting Hantaan-type hantavirus and detection method thereof
  • Kit for detecting Hantaan-type hantavirus and detection method thereof
  • Kit for detecting Hantaan-type hantavirus and detection method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1, Hantavirus (Hantan type) primer design and specificity verification

[0052] (First, the purpose

[0053] The Hantaan-type primer set involved in the Hantavirus was designed, and its specificity was detected by dye method qPCR.

[0054] (2) Materials, reagents and instruments

[0055] 1. Main equipment

[0056] equipment name factory CFX96 TM Real-Time System

Bio-Rad

[0057] 2. Main reagents

[0058]

[0059] 3. Experimental materials (randomly select two RNA samples for testing)

[0060] name source Types of A260 A260 / A280 Concentration (ng / μL) YSFH-F-5 mouse lung tissue RNA 6.68 2.12 267.1 YSFHF28 mouse lung tissue RNA 5.17 2.23 206.71

[0061] 4. Primer Synthesis

[0062]

[0063] (3) Experimental process

[0064] 1. cDNA synthesis system and process

[0065]

[0066] 2. cDNA sample processing

[0067] The above 20 μL cDNA template was rehydrated to 100 μL, and ali...

Embodiment 2

[0092] The specificity verification of embodiment 2 Hantavirus (Hantan type) primers in negative samples

[0093] (First, the purpose

[0094] Validation of specificity of Hantan-type primers in negative samples.

[0095] (2) Materials, reagents and instruments:

[0096] 1. Main equipment

[0097] equipment name factory CFX96 TM Real-Time System

Bio-Rad

[0098] 2. Main reagents

[0099]

[0100] (3) Experimental process

[0101]

[0102]

[0103] (4) Test results

[0104] 1.Ct value

[0105] Primer name target fragment sample to be tested sample type Ct value Remark HAN-S-1F / R Hantan type S fragment HLD-F-10 Hantan type negative 37.78 not detected HAN-S-1F / R Hantan type S fragment YSFH-F-28 Hantan positive N / A not detected HAN-M-4F / R Hantan type M fragment YSFH-24 Hantan positive 31.14 check out HAN-M-4F / R Hantan type M fragment HLDF-10 Hantan type negative 37....

Embodiment 3

[0114] Example 3 Hantavirus (Hantan type) probe design and specificity verification-test positive and negative samples

[0115] (First, the purpose

[0116] The probes HAN-L-2p and HAN-M-4p were designed and synthesized, and the specificity of the primer-probe combination was verified by qPCR.

[0117] (2) Materials, reagents and instruments:

[0118] 1. Main equipment

[0119] equipment name factory CFX96 TM Real-Time System

Bio-Rad

[0120] 2. Main reagents

[0121] name Item No. factory PerfeCTa qPCR ToughMix UNG 95138 Quantabio

[0122] 3. Probe Synthesis

[0123] Primer / Probe Name sequence (5'-3') fluorescent label target gene HAN-L-2p AATTGCGACAGCCACATGGTT 5'FAM, 3'BHQ1 Hantan type L fragment HAN-M-4P CGGCTGCGGTATGATTCTTCCAC 5'HEX,3'BHQ1 Hantan type M fragment P_β-actin TACTCCTGCTTGCTGATCCACATC 5'CY5, 3'BHQ2 animal source

[0124] (3) Experimental process

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit for detecting Hantaan-type hantavirus and a detection method thereof, the kit contains a primer for detecting and typing the Hantaan-type hantavirus, the primer is designed aiming at a Hantaan-type L gene segment, a Hantaan-type S gene segment and a Hantaan-type M gene segment, and each type relates to two target probe sets and one internal standard probe set.

Description

technical field [0001] The invention belongs to the field of medicine and biology, and relates to a virus detection method, in particular to the detection and identification of Hantaan virus. Background technique [0002] Hantavirus (HV) belongs to the genus Hantavirus of the family Bunyaviridae and is a segmented, single-stranded, negative-strand RNA virus whose genome consists of S (small), M (medium) and L ( large) consists of three segments. So far, 23 serotypes of hantaviruses have been identified in the world, and different hantaviruses are different in pathogenicity, disease spectrum and natural carrier hosts. Clinically, the virus mainly causes Hemorrhagic Fever with Renal Syndrome (HFRS) in Eurasia and Hantavirus Pulmonary Syndrome (HPS) in the Americas. [0003] my country is a country with a high incidence of hemorrhagic fever with renal syndrome, and the number of reported cases is 20,000-50,000 every year, accounting for more than 90% of the total number of th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6851C12Q2531/113C12Q2563/107C12Q2563/159
Inventor 张晓龙慈颖梁慧杰刘莹莹李颖曹晓梅冯进杨艳
Owner CHINESE ACAD OF INSPECTION & QUARANTINE
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com