Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker related to pericarp color under eggplant sepal coverage and application

A molecular marker, eggplant technology, applied in the determination/inspection of microorganisms, DNA/RNA fragments, recombinant DNA technology, etc., which can solve the problem of little research on the genes related to the regulation of fruit color under the calyx.

Active Publication Date: 2021-05-18
天津市农业科学院
View PDF6 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are very few studies on the genes related to the regulation of calyx fruit color, especially whether the calyx fruit color is related to senescence genes. There is an urgent need for an efficient molecular marker to assist this patent. Apply bioinformatics to predict candidate genes, and use their SNP sites to develop KASP markers, and verify them in known genotype populations, in order to develop calyx fruit color-linked KASP markers for assisted breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker related to pericarp color under eggplant sepal coverage and application
  • Molecular marker related to pericarp color under eggplant sepal coverage and application
  • Molecular marker related to pericarp color under eggplant sepal coverage and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Determination of Example 1 Molecular Markers

[0036] 1.1 Experimental materials

[0037] The experiment was carried out at the Wuqing Innovation Base of Tianjin Academy of Agricultural Sciences in 2018. In the spring, the experimental seeds Y5 from the Germplasm Resource Bank of the Vegetable Research Institute of Tianjin Academy of Agricultural Sciences were used as the female parent, and Y73 was used as the male parent. F1 hybrids were prepared and harvested. In the spring of 2019, the F1 generation was planted and self-crossed to obtain the F2 generation seeds. In the autumn of 2019, the parents Y5, Y73 and F2 generation seeds were planted at the same time. Seedlings were sown on June 15, and they were planted in multi-span greenhouses on July 16. Plant 20 plants with parental materials and 185 plants with F2 populations. The row spacing between plants is 60cm×70cm, covered with black plastic film, and conventional cultivation management. The planting environment i...

Embodiment 2

[0057] The determination of the specific primer of embodiment 2 molecular marker

[0058] 2.1 100bp base information before and after the mutated base

[0059] >SNP1→chr10→2618543→2618743

[0060] AAGCAATGGATATGGGAAGTGCTGGCAAGGCATGTCGACACACAGCTAACAATAATAAGTGTGCACCCTAATCCAGATATAATAGCGAGATAACAAGCAT[A / G]AACAGTCATCAAAATCATACATTGCAGCTCTCCCCACCAACACACTATAGAAAACAAAATCTCCTAAACCAAGCTTTATCCCCCTCCCTCTCTCCTCCTCT

[0061] 2.2 Design KASP primers according to the information of mutated bases

[0062] Such as Figure 4 , the KASP primers include upstream primer 1, upstream primer 2 and downstream primer.

[0063] Upstream primer 1:

[0064] GAAGGTGACCAAGTTCATGCTGCTGCAATGTATGATTTGATGACTGTTT.

[0065] Upstream primer 2:

[0066] GAAGGTCGGAGTCAACGGATTGCTGCAATGTATGATTTGATGACTGTTC.

[0067] Downstream primer: CAATGGATATGGGAAGTGCTGGC.

[0068] The sequence of the upstream primer 1 is shown in SEQ ID NO:2, the sequence of the upstream primer 2 is shown in SEQ ID NO:3, and the sequence of th...

Embodiment 3

[0072] Example 3 Verification of Molecular Markers

[0073] 3.1 Test material

[0074] The breeding materials in the fall of 2020 and the spring of 2021 include two types of eggplants, purple under the calyx and green eggplant under the calyx, with a total of 91 experimental materials.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a molecular marker related to a pericarp color under eggplant sepal coverage and application. Specifically, an SNP locus closely linked with an eggplant senescence gene is provided, and a KASP marker is developed, the marker can assist in screening weak light resistant eggplant materials, can eliminate environmental and manual operation errors, facilitates batch operation, and can save land and labor cost and improve breeding efficiency by seedling selection.

Description

technical field [0001] The application belongs to the field of biomolecular detection and breeding, and specifically relates to a molecular marker related to the color of the pericarp covered by eggplant sepals and its application. Background technique [0002] Competitive allele-specific PCR (KASP) technology is a primer designed for both ends of the allele SNP site. Real-time fluorescent PCR technology is used to amplify the substrate, and the corresponding fluorescent probe can bind to the corresponding primer binding site. In combination, the genotype of the amplified product is determined according to the detected fluorescent color, which is a new, fast and simple method without electrophoresis. [0003] With the rapid development of facility agriculture, the joint influence of greenhouse cover and northern smog, the problem of poor coloring of eggplant and other vegetable varieties has become more and more serious. In the final analysis, the variety is not strong in lo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 王利英乔军刘婧李素文王立宾田立鹏王清源
Owner 天津市农业科学院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com