Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A molecular marker related to the color of the pericarp covered by eggplant sepals and its application

A technology of molecular markers and eggplants, which is applied in the determination/inspection of microorganisms, DNA/RNA fragments, biochemical equipment and methods, etc., can solve the problem of little research on genes related to calyx fruit color regulation, and achieve easy batch operation , saving manpower, saving land and labor costs

Active Publication Date: 2021-08-10
天津市农业科学院
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are very few studies on the genes related to the regulation of calyx fruit color, especially whether the calyx fruit color is related to senescence genes. There is an urgent need for an efficient molecular marker to assist this patent. Apply bioinformatics to predict candidate genes, and use their SNP sites to develop KASP markers, and verify them in known genotype populations, in order to develop calyx fruit color-linked KASP markers for assisted breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker related to the color of the pericarp covered by eggplant sepals and its application
  • A molecular marker related to the color of the pericarp covered by eggplant sepals and its application
  • A molecular marker related to the color of the pericarp covered by eggplant sepals and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Determination of Molecular Markers

[0036] 1.1 experimental materials

[0037] In 2018, in 2018, Wuqing Innovation Base in Tianjin Agricultural Sciences, the Spring is the experiment seed y5 of the genital repository of the Tianjin Agricultural Sciences Vegetable Research Institute, Y73 is a parent, formulated a combination and harvest F1 hybrid. In the spring of 2019, F1 was planted and passed from the self-cultivation, and the parent Y5, Y73 and F2 generation seeds were grown in the fall of 2019. On June 15th, seedling seedlings were planted on July 16, which was planted in the joint greenhouse. The parental materials were cultivated, and 185 F2 groups were planted, the line distance of 60 cm × 70cm, black film coverage, conventional cultivation management. The planting environment is a joint greenhouse, which is in advance, and the concentration is sprayed, and the concentration is controlled, so that the light shielding rate reaches 83% (referring to the bran...

Embodiment 2

[0057] Embodiment 2 Determination of specific primers of molecular markers

[0058] 2.1 100bp base information before and after variation base

[0059] > SNP1 → CHR10 → 2618543 → 2618743

[0060] AAGCAATGGATATGGGAAGTGCTGGCAAGGCATGTCGACACACAGCTAACAATATAAGTGTGCACCCTAATCCAGATATAATAGCGAGATAACAAGCAT [A / G] AACAGTCATCAAATCATACATTGCAGCTCTCCCCACCAACACACTATAGAAAACAAAATCTCCTAAACCAAGCTTTATCCCCCTCCCTCTCTCCTCCTCT

[0061] 2.2 Design KASP primers according to variant base information

[0062] like Figure 4 The KASP primer includes an upstream primer 1, an upstream primer 2, and a downstream primer.

[0063] Upstream primer 1:

[0064] Gaaggtgccaagttcatgctgctgcaatgttgattgatgactgttt.

[0065] Upstream primers 2:

[0066] Gaaggtcgggg atcaacgattgctgcaatgttgattgatgactgttc.

[0067] Downstream primers: caatgatatgggaagtgctggc.

[0068] The sequence of the upstream primer 1 is shown in SEQ ID NO: 2, and the sequence of the upstream primer 2 is shown in SEQ ID NO: 3, and the sequence of the downstream ...

Embodiment 3

[0072] Example 3 Verification of Molecular Markers

[0073] 3.1 Test Materials

[0074] In the autumn of 2020 and the 2021 spring season breeding materials, including two types of purple and duty under green eggplants, a total of 91 experimental materials.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses a molecular marker related to the color of the subcarp covered by eggplant sepals and its application. Specifically, the present invention provides a SNP locus closely linked to the eggplant senescence gene, and develops a KASP marker, which can assist in the screening of low-light resistant eggplant materials, can eliminate environmental and human error, and is easy to operate in batches , Seedling selection can save land and labor costs, and improve breeding efficiency.

Description

Technical field [0001] The present application belongs to the field of biomolecule detection and breeding, and in particular, a molecular marker and application associated with the color of the peeling of eggplant sepals. Background technique [0002] Competitive allele specific PCR (KASP) technology is two-end primers designed for the allele SNP site, using real-time fluorescent PCR technology, the substrate is amplified, and the corresponding fluorescent probe can be combined with the corresponding primer binding site. In combination, the genotype of the amplified product is determined based on the detected fluorescent color, is a quick and easy way for a new type of electrophoresis. [0003] With the rapid development of facility agriculture, the co-influence of greenhouse coverage and the northern smog weather, the problem of poor variety of vegetables such as eggplant is more serious, and the root is not weak. The color of the eggplant is recognized by the weak light indicat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 王利英乔军刘婧李素文王立宾田立鹏王清源
Owner 天津市农业科学院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com