Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for creating endogenous herbicide-resistant rice with high resistance and stability

A herbicide-resistant and herbicide-resistant technology, applied in the field of plant biology, can solve problems such as high cost, low probability, and bad mutations

Pending Publication Date: 2021-05-18
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Using chemical mutagenesis, radiation mutagenesis and other methods to produce herbicide-resistant plants has a high probability of low cost and may cause chain adverse mutations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for creating endogenous herbicide-resistant rice with high resistance and stability
  • Method for creating endogenous herbicide-resistant rice with high resistance and stability
  • Method for creating endogenous herbicide-resistant rice with high resistance and stability

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Obtaining of the pHUN411-BE3 targeting vector containing the target sequence.

[0038] 1. Select the nucleotide sequence from position 6093 to position 6113 in the rice OsACC gene (LOC4338322), the sequence is CCT CTGTTCATCCTCGCTAACTG, (the underlined part is the reverse complementary sequence of the PAM sequence of NGG structure, wherein, N is A, T, G or C), as the targeting site.

[0039] 2. Synthesize (entrust BGI) forward oligonucleotide chain (OsACC P1) and complementary reverse oligonucleotide chain (OsACC P2) according to the selected target site,

[0040] The specific sequence is:

[0041] OsACC P1: GGCA CAGTTAGCGAGGATGAACAG

[0042] OsACC P2: AAAC CTGTTCATCCTCGCTAACTG

[0043] The part not underlined is the NGG-removed sequence or complementary sequence in the above target site, and the underlined part is the cohesive end used to connect the vector.

[0044] 3. Perform an annealing procedure on OsACC P1 and OACC P2, and anneal the two strands of OsACCP...

Embodiment 2

[0048] Example 2: Agrobacterium-mediated genetic transformation of rice

[0049] (1) Callus induction The sterilized rice seeds were soaked overnight in sterile water at 30°C in the dark, and the embryos were peeled off with a scalpel and placed on the induction medium. Place 12 embryos evenly in each dish (disposable plastic petri dish with a specification of 100×25mm, containing 50ml of induction medium), and place them in the dark at 30°C for 2 to 3 weeks to induce callus until light yellow granules grow. healing.

[0050] (2) Pre-cultivation Select the granular callus without lesion from the induction medium, place it on a new induction medium, and culture it in the dark at 30°C for 3-5 days.

[0051] (3) Infection and co-cultivation Transfer the pre-cultured callus to a 50ml sterile tube, add the Agrobacterium bacterium liquid obtained in Example 1 (the OD value of the bacterium liquid is in the range of 0.1~0.2) and soak for 20min, Pour out the bacterial solution, and ...

Embodiment 3

[0056] Example 3: Detection of ACCase base mutation sites in herbicide-resistant rice

[0057] Extract the leaf DNA of positive plants in the resistant rooting medium of 50 mg / l hygromycin and 9 μmol of metilofop as the selection agent, and design the following pair of primers for editing the ACCase gene target position, ACC FP: gctgtggagactcagaccatga

[0058] ACC RP: gtttatcttgctatcaaccaca

[0059] Amplify the upstream and downstream sequences of the target site. The amplified products were subjected to Sanger sequencing. Compared with the wild-type ACCase gene sequence, it was found that the 6113 nucleotide G on the rice ACCase gene with herbicide resistance was replaced by a nucleotide C ( figure 2 ). The pHUN411-BE3 system mediated C:G mutation to T:A site-specific substitution. The inventors of the present application found that the nucleotide G on the ACCase mutant gene was replaced by C, which is a non-target produced by the pHUN411-BE3 system. to mutation. This p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for creating novel herbicide-resistant rice through a plant base editing technology. A specific target sequence of a rice acetyl-coenzyme A carboxylase (ACCase) gene provided by the invention is utilized, and a single-base editing vector is used for site-specific replacement of the specific target of the coding gene of rice ACCase, so that an ACCase gene mutant with the 6,113th nucleotide G in the nucleotide sequence of the coding gene of the wild-type ACCase substituted by nucleotide C is obtained; and tryptophan at the 2,038th site of a correspondingly coded amino acid sequence is mutated into serine, so that ACCase mutant protein is obtained. The rice containing the protein has resistance to a haloxyfop-methyl herbicide. The haloxyfop-methyl herbicide-resistant rice prepared by the invention can tolerate spraying treatment of 80 mg / ml of haloxyfop-methyl herbicides, and has very high breeding and cultivation values.

Description

technical field [0001] The invention relates to the field of plant biotechnology. Specifically, the present invention relates to a method for creating new herbicide-resistant plants through plant base editing technology. Background technique [0002] Field weeds compete with crops for water, fertilizer, light and growth space, directly affecting crop yield and quality. At the same time, many weeds are intermediate hosts of crop pathogenic bacteria and pests, and are one of the important biological limiting factors for crop production. At present, the selective herbicides widely used in the market are applied in a large amount and have a long residual period, which easily affects the normal growth of the next crop. Bacterial herbicides such as methotop have the characteristics of high efficiency, low toxicity, easy degradation, and no residue. But they are not selective for weeding and cannot be used directly in the growing season of crops. Breeding rice resistant to such...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/82C12N9/00C12N15/52A01H5/00A01H6/46A01H4/00
CPCC12N15/113C12N9/93C12N15/8274A01H4/00C12Y604/01002C12N2310/20
Inventor 秦瑞英许蓉芳刘小双李娟廖圣祥魏鹏程李浩
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com