Fluorescent probe primer group and kit for African swine fever virus P72 gene, and application thereof
An African swine fever virus and fluorescent probe technology, applied in the field of animal pathogen detection, can solve the problems of complex immune evasion mechanism, no treatment measures, lack of neutralizing antibodies, etc., and achieve improved Tm value, improved sensitivity and strong specificity. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0039] A fluorescent probe primer set of African swine fever virus P72 gene, comprising:
[0040] Upstream primer ASFV-F: 5'-CCACGGGAGGAATACCAA-3';
[0041] Downstream primer ASFV-R: 5'-GCAGATGCCGATACCACA-3';
[0042] Fluorescent probe ASFV-P: contains the fragment 5'-TCATATTAACGTATCCAGAGCAAGA-3', and is labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end. The fluorescent reporter group is FAM, and the fluorescent quencher group The group is TAMRA.
[0043]A kit comprising the fluorescent probe primer set as described above, also includes a positive control, a negative control and a PCR amplification solution, and the positive control is a recombinant plasmid containing a 125bp target fragment (the sequence is CCACGGGAGGAATACCAACCCAGTGGTCATATTAACGTATCCAGAGCAAGAGAATTTTATTAGTTGGGACACGGATTACGTGGGGTCTATCACTACGGCTGATCTTGTGGTATCGGCATCTGC, such as SEQ ID NO: As shown in 4, the sequence is based on the analysis of 17 domestic and se...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com