Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent probe primer group and kit for African swine fever virus P72 gene, and application thereof

An African swine fever virus and fluorescent probe technology, applied in the field of animal pathogen detection, can solve the problems of complex immune evasion mechanism, no treatment measures, lack of neutralizing antibodies, etc., and achieve improved Tm value, improved sensitivity and strong specificity. Effect

Pending Publication Date: 2021-05-14
FUJIAN AONONG BIOLOGICAL TECH GRP CO LTD +3
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is no effective treatment after the onset of African swine fever, and the African swine fever virus has a complex immune evasion mechanism, lacks typical neutralizing antibodies, and has no effective vaccine for epidemic prevention. Therefore, a rapid, sensitive and accurate detection method is established appears to be particularly important

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent probe primer group and kit for African swine fever virus P72 gene, and application thereof
  • Fluorescent probe primer group and kit for African swine fever virus P72 gene, and application thereof
  • Fluorescent probe primer group and kit for African swine fever virus P72 gene, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0039] A fluorescent probe primer set of African swine fever virus P72 gene, comprising:

[0040] Upstream primer ASFV-F: 5'-CCACGGGAGGAATACCAA-3';

[0041] Downstream primer ASFV-R: 5'-GCAGATGCCGATACCACA-3';

[0042] Fluorescent probe ASFV-P: contains the fragment 5'-TCATATTAACGTATCCAGAGCAAGA-3', and is labeled with a fluorescent reporter group at the 5' end and a fluorescent quencher group at the 3' end. The fluorescent reporter group is FAM, and the fluorescent quencher group The group is TAMRA.

[0043]A kit comprising the fluorescent probe primer set as described above, also includes a positive control, a negative control and a PCR amplification solution, and the positive control is a recombinant plasmid containing a 125bp target fragment (the sequence is CCACGGGAGGAATACCAACCCAGTGGTCATATTAACGTATCCAGAGCAAGAGAATTTTATTAGTTGGGACACGGATTACGTGGGGTCTATCACTACGGCTGATCTTGTGGTATCGGCATCTGC, such as SEQ ID NO: As shown in 4, the sequence is based on the analysis of 17 domestic and se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a fluorescent probe primer group and a kit for an African swine fever virus P72 gene, and application thereof. The primer comprises an upstream primer ASFV-F: 5 '-CCACGGGAGGAATACCAA-3', the downstream primer ASFV-R is 5 '-GCAGATGCCGATACCACA-3'; a fluorescent probe ASFV-P, containing a fragment 5 '-TCATTAACGTATCCAGAGCAAGA-3', the 5' end of the fluorescent probe ASFV-P is marked with a fluorescent reporter group, and the 3 ' end of the fluorescent probe ASFV-P is marked with a fluorescent quenching group. The kit comprises a fluorescent probe primer group, a positive control, a negative control and a PCR amplification solution. The application specifically comprises the following steps: 1) extracting total DNA of a sample to be detected; 2) taking the total DNA obtained in the step 1) as a template, preparing a fluorescence reaction system by using the kit, and carrying out fluorescence amplification; and (3) establishing a standard curve by utilizing positive control, analyzing a fluorescence amplification product, and judging whether the sample to be detected is positive or negative according to an amplification reaction result. Compared with the prior art, the primer group has the advantages that all current epidemic ASFV strains can be identified to the maximum extent, and the sensitivity of the primer is improved to 1.15 * 10 < 1 > copise / [mu]L.

Description

technical field [0001] The invention belongs to the field of animal pathogen detection, and in particular relates to a fluorescent probe primer set, kit and application of African swine fever virus P72 gene. Background technique [0002] African swine fever (ASF) is an acute, febrile, highly contagious disease of pigs caused by African swine fever virus (ASFV). Domestic pigs and wild boars are generally susceptible, and soft ticks are the storage host and medium of ASFV. The incubation period of ASFV is 5-15 days. Once an outbreak occurs, the course of disease is short and the case fatality rate is high, which can reach 100%. The clinical symptoms of African swine fever are complex and difficult to distinguish from other diseases, mostly manifested as high fever, skin congestion, abortion, edema and organ hemorrhage. There is no effective treatment after the onset of African swine fever, and the African swine fever virus has a complex immune evasion mechanism, lacks typica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6851C12Q2531/113C12Q2563/107C12Q2545/113
Inventor 张蓉沈俊杰凌勇刘鸣慧余杰张志刚吴有林
Owner FUJIAN AONONG BIOLOGICAL TECH GRP CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products