Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Probe set for detecting amplification level of HER2 gene and application of probe set

A gene amplification and probe set technology, applied in the field of probe sets for detecting the level of HER2 gene amplification, can solve the problems of large number of probes, slow detection results, long detection time, etc.

Pending Publication Date: 2021-05-14
WUHAN YZY MEDICAL SCI & TECH
View PDF16 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The biggest disadvantage of the existing fluorescence in situ hybridization technology is that the detection time is long, the number of probes is large, the cost is high, and the detection time is often more than 12 hours. Slow results are often an important factor in the tension between doctors and patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe set for detecting amplification level of HER2 gene and application of probe set
  • Probe set for detecting amplification level of HER2 gene and application of probe set
  • Probe set for detecting amplification level of HER2 gene and application of probe set

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] This embodiment provides a method for preparing a probe set for detecting the amplification level of the HER2 gene, which specifically includes the following steps:

[0024] S1, based on the sequence of the HER2 gene, design a nucleotide sequence containing 45 bases / 60 bases / 80 bases in the region without repetitive sequences, and set the Tm value of the probe at 50°C. The GC content ranges from 40 to 60%. After discarding the sequences containing AAAA / TTTT / CCCC / GGGG, 1702 candidate probes were obtained. After the whole gene (hg38) BLAST comparison analysis, a total of 1245 nucleotides were finally obtained Sequence, specifically as shown in Table 1 below;

[0025] S2, add a 20bp tag sequence to the 5' end of each nucleotide sequence and a 20bp tag sequence to the 3' end to obtain a series of characteristic primers with tag sequences, wherein the 5' end tag sequence is : TAATACGACTCACTATAGGG, the 3' end tag sequence is: CCGCTGAGCAATAACTAGCA;

[0026] S3, using high-th...

Embodiment 2

[0045] Embodiment 2 Normal people's peripheral lymphocyte droplet experiment

[0046] Materials: human peripheral blood lymphocyte culture medium, colchicine, hypotonic solution (0.4% KCl), fixative solution (methanol:acetic acid=3:1, volume ratio).

[0047] S1, cell culture and synchronization: take 0.4mL heparin anticoagulated whole blood (from the hospital) in human peripheral blood lymphocyte culture medium, mix well and store at 37°C, 5% CO 2 Cultivate in a constant temperature incubator for 72 hours, and 4 hours before termination, add colchicine to the medium to a final concentration (0.1 μg / mL) and continue to cultivate for 4 hours;

[0048] S2, collection and fixation: collect the medium, centrifuge at 500g for 5min, discard the supernatant, add 0.4% KCl hypotonic solution and incubate for 30min, then fix the cells with methanol-glacial acetic acid mixture, let stand at room temperature for 10min, centrifuge at 500g to pellet the cells , repeat the cell fixation step o...

Embodiment 3

[0055] Referring to the method in Example 2, the slide containing 50 metaphase lymphocytes was detected, and the results are shown in Table 3 below. It can be seen that there are 99 FISH signal points of the HER2 gene probe, and the sensitivity reaches 99%.

[0056] Table 3 Sensitivity test results of probes

[0057] probe type Metaphase lymphocytes (units) FISH signal points (pieces) sensitivity HER2 gene probe 50 99 99％

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene detection, in particular to a probe set for detecting the amplification level of the HER2 gene and application of the probe set. The probe set is prepared from a nucleotide sequence shown in a specification table 1. In a non-repetitive region of the HER2 gene, a plurality of oligonucleotide libraries with different lengths are adopted, and on the basis of using as few probes as possible, the resolution of the probe is increased; and a PCR doping method is also adopted in the preparation process to ensure that the product contains more fluorophores. The probe set is used for detecting the amplification level of the HER2 gene, FISH hybridization of a paraffin tissue sample can be completed within 30 minutes, sensitivity is high, specificity is strong, a hybridization background is clean, and a signal-to-noise ratio is low.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a probe set for detecting HER2 gene amplification level and its application. Background technique [0002] The epidermal growth factor receptor (EGFR) pathway is an important pathway affecting tumors. EGFR belongs to the tyrosine kinase receptor family, mainly on the surface of epithelial tissue cells, including HER1, HER2, HER3 and HER4. Among them, HER2 is a transmembrane glycoprotein p185 with a molecular weight of 185kD encoded by the proto-oncogene HER2 / neu. HER2 gene amplification increases cell differentiation, local and distant metastasis, migration, reduces cell apoptosis, accelerates angiogenesis, and tumor invasion , Local and distant metastasis are closely related. Basic research shows that the overexpression of HER2 can promote the metastasis of tumor cells. On the one hand, it promotes the migration by regulating the expression of adhesion factors such as ep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6811C12N15/11
CPCC12Q1/6886C12Q1/6811C12Q2600/158C12Q2531/113C12Q2563/107
Inventor 祝丹平魏亮肖书圣郭林
Owner WUHAN YZY MEDICAL SCI & TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com