Primer composition for detecting TERT promoter methylation and application thereof
A primer composition and a technology for detecting primers, which are applied in the determination/inspection of microorganisms, recombinant DNA technology, biochemical equipment and methods, etc., to achieve the effect of wide application range, strong feasibility and not easy to degrade
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Methylation site on TERT gene
[0036] The present invention is based on the Illumina 450K chip of TCGA kidney cancer patients, and analyzes the difference in methylation degree according to the methylation sites on the TERT gene in tumor tissue and normal tissue, and it is identified that cg11625005 is a site with a significant difference in methylation degree. Located 554bp upstream of the promoter of the TERT gene. figure 1 It is the relationship between the methylation level of TERT cg11625005 site and the stage, grade, survival and prognosis of renal cancer patients.
[0037] Based on the data of TCGA kidney cancer patients, the present invention finds for the first time that the methylation level of TERT cg11625005 site is closely related to the stage, grade, survival and prognosis of kidney cancer patients.
Embodiment 2
[0038] Example 2 Kit
[0039] Primers were synthesized by SangonBiotech, and the specific primer sequences are as follows:
[0040] cg11625005-F (SEQ ID NO: 1): GGGTTTGTGTTAAGGAGTTTAAG;
[0041] cg11625005-Rbio (SEQ ID NO: 2): AAAACCCAAAAACTACCTCCA;
[0042] cg11625005-S (SEQ ID NO: 3): GTGTTAGTTTAGGGAGTAATG.
Embodiment 3
[0043] Embodiment 3 TERT gene methylation detection
[0044] 1. Extract DNA samples from tumor tissue and normal tissue (or patient's body fluids, such as blood, urine, etc.) according to the commercial genome extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No. DP304).
[0045] 2. Take 0.5-1μg DNA sample and use methylation transformation kit EZ DNAMethylation-Gold TM Kit (ZYMO, D5006) for transformation and purification.
[0046] 2.1 Sample homogenization: use a NanoDrop ND-2000 spectrophotometer to determine that the sample concentration is greater than 50ng / μL, and the total amount of the sample is greater than 500ng.
[0047] 2.2 Reagent preparation:
[0048] Reagent 1: add 900 μL H 2 O, 300 μL M-Dilution Buffer, 50 μL M-Dissolving Buffer (into CT Conversion Reagent tube, shake at room temperature for 10 min.
[0049] Reagent 2: Add 96mL of 100% ethanol to M-Wash Buffer.
[0050] 2.3 According to Table 1, prepare the bisulfite conversion reac...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com